__

Irrelevant Part II

2012-02-16T02:43:00.001+08:00

/golek golek. TT_________TT KAWAII. AIBA CHAN KAWAII

Batang pancing.

2012-02-16T02:35:00.001+08:00

Somehow, my holiday is over and hello i am here again. =o= at univ.

kepala saya benjol ni

semalam waktu kat rumah. waktu saya tengah gegelak tengok Kaibutsu kun, dalam kul sebelas lebih ah. i meant, 3rd brother dah tido. bebudak skolah tadika tak banyak nak pikir hihi. tidur awal pukul 10.

then masa tu ada tetamu. so of course lari masuk bilik .

then time saya gegelak tengok Kaibutsu kun, tetiba ada benda jatuh atas kepala saya

Q____________Q TAU TAK APA JATUH ATAS KEPALA AKU

BATANG PANCING =______________________=

i was like. tediam 2 saat then golek golek kesakitan. gila TTwTT omg omg gila sakit. nasib baik kena part hujung, yang agak ringan (berbanding komponen pemancingan yang lain OTL) but it still.. itaiiiiiiiiiiiiiii ;~~~~; (nasib baik tak bedarah OTL)

i was like omg serious misteri. kenapa atas almari baju aku ada batang pancing TTwTT. i want to ask my papa today but i forget tsk tsk.

why weird things always happen to me why why
dah la bye

p/s: hero kaibutsu kun tu ohno satoshi. =______= dan hobi dia suka memancing. so technically waktu aku tengok drama dia, aku kena hempap batang pancing. so nikki chan and aida senpai cakap itu bermakna ohno cintakan saya la kan hikhik.

p/s: sakit ..gila. Q_Q pecaya lah

Irrelevant

2012-02-14T13:52:00.000+08:00

Matsujun's

Ohchan's

Sho chan's

Nino's (HAHAHAHAHAHAH)

AND FINALLY.

AIBA CHAN'S HAHAHAHAHHAHAHAHAHAHAHAAH

*laugh until teary eyes*

/lap air mata

AIBA MASAKI why you so funny why why why why why xDDD

i swear 2012, arashi totally own me. bye kpop

Genetically modified half nippon babies D: ?

2012-02-09T13:22:00.000+08:00

@_aimiya wah wah manusia Leo! Watashi mo! Tapi, x elok pilih partner sama perangai, nanti stress bila 2-2 emo =___=

@kuragerogero ... idk nikki. saya da tepikir nama anak tapi i cant see myself kawin HAHAHAHA. IDK. IT IS SO RANDOM OTL (but i think lelaki

@_aimiya lol me too. Nak ada boyfriend pun X boleh bayang, apa lagi nak kawen. It's too weird for me D:

@kuragerogero but wth i had random though about my future half nippon musuko ? =__= Kei chan and Sho chan

@_aimiya aww Kei and Sho, nama yang sangat cute! X3 normal laaa, saye pun ada bayang2 jugak xD

@kuragerogero trololo. and all i want is musuko. no no musume OTL yes. kei i took it from watak nino in GANTZ. sho. well.. =w=

@_aimiya why not Kazu? XD I want both haha tapi x nak la ramai sangat OTL

@kuragerogero OTL hahahah okey my last son. Ichiban me Kei chan, Niibanme, Sho chan, sanbanme, Kazu chan. (plan-soar-harmony) nicee

@kuragerogero youuu what is your half nippon babies namae xD

@_aimiya haha! Haven't thought much, tapi 1st musuko mesti nama Mamoru. Musume pulak, hmmm, Mayu, maybe? Hahaha

@kuragerogero lol mamoru. nama ayah ohchan xDDDDDD

@kuragerogero and my sensei name. ueda mayu desu.

@_aimiya wahahaaa really? But saya suka laa, like, he'll be the one to protect his siblings. XD

@kuragerogero yes yes. mamoru ;3 nice name! the protector! nama anak sulung ni xDDDDDDDDDDDDDDDDD

p/s

KEI (1-恵, 2-佳, 3-敬, 4-圭, 5-慧) meaning 1) "blessed, lucky," 2) "excellent," 3) "respect," 4) "square jewel," or 5) "wise."

KAZUO (1-和夫, 2-一男) meaning 1) "harmonious man" or "first male".

MAMORU (守) meaning "protector."

MAYU 真優, 満夕 meaning 真 (ma) "true" or 満 (ma) "full" combined with 優 (yu) "gentleness, superiority" or 夕 (yu) "evening".

SHO (翔) meaning "to fly, to soar" or "wind instrument."

no specific reason behind this name. hewhew (although i have to admit, Kei is derived from GANTZ's Kurono Kei)

p/s lol apa da pikir nama future half nippon babies tapi cant even seen own future pasal kawen (sebab kawen nanti kena share semua harta benda -__- lol that awkward moment) . ni in vitro fertilization ke hape xD

p/s

=_____= buku teks english budak budak sekolah jepun. ada latih tubi pasal SHO lagi tau. ko mampu?

byee

ただいま!

2012-02-06T18:57:00.001+08:00

ketika gua menulis entri ni, gua tengah rileks rileks kat bilik gua kat rumah. =w=

tekejut tak tekejut tak xD

even parent gua pun tekejut

hahaha actually saya book tiket then balik then pegi jenjalan kl dulu then baru naik bas balik rumah. sampai je kat bus station around muar baru tehegeh hegeh mesej mak

"MAMA KITA KAT BAS STATION NI TAKDE BAS NAK HANTAR BALIK RUMAH"

and as expected 1 minute after le message delivered, my mom called me and start asdffghjjklasdfghjkl hahahahahahah 8D beliau siap tanya lagi haihhhhh apsal tiba tiba balik, tak cakap haihh hahahahahaha

=w= another ninja mission accomplished yo (dan sedikit digagalkan oleh syarikat bas setempat cis ;A;)

but nonetheless i had such a good day yesterday hewhewhew. mula mula pegi pesta buku somewhere dekat pwtc .. it turns out to be.. well ... ahh kat situ banyak jual buku agama (then saya tak paham kenapa diorang namekan pesta tu pesta buku 1 malaysia hmm).

then pegi la mph dekat mid.

saya kan -_- .. hm, bukan minat sangat membaca D: i know. when i was young *kengkonon macam sekarang dah tua*, i love to read but when i grow up, saya tak tau mana pegi minat tu ~_~ OTL i meant masa matrix masih suka membaca because masa zaman matrix saya tengah gila harry potter (i am ron weasley biased 8D).

but but i promised to my dad to used le voucher wisely (which sekarang saya jadi sengsara sebab janji janji manis itu OTL) jadi saya beli la benda benda ni ~_~

1) Comprehensive Japanese (it is like a thick kitab with a lot of Japanese grammatical chapter ~ around forty ringgit something) xD
2) Random pilot stationary. =w=
3) A bookmark
4) A highlighter.

so technically voucher saya masih berbaki 150 dan tatau nak beli apa pakai tu OTL. bye

kehilangan cinta duda sengsara

2012-02-01T23:35:00.002+08:00

お誕生日おめでとう朽木白哉隊長!~
semalam birthday duda sengsara

duda sengsara D:

birthday dia yang ke 242. tua kerepot dah. tapi mengapa kau sangat kacak -__-

(BLEACH 355)

well technically the name, duda sengsara, it was derived from intan. ianya bermula macam ni. OTL. mula mula, masa tu saya tak kenal Nikkichan lagi. tapi saya selalu spam wall facebook intan pasal Bleach dan nikki chan apparently join together gether jugak and hello all fangirls adalah bersaudara ;A; ditambah lagi dengan populasi otaku yang semakin pupus mesti lah hubungan sillaturrahim yang baik TTwTT tapi masa tu i was too shy to add nikkichan since she listed all le awesome jrock and visual kei band at her "about me" section dan daku beranggapan siapalah daku untuk add orang awesome ini.

CETT it was years ago. and nikki chan actually yang first add saya OTL (arigapyon! (≧∇≦)ﾉ)

okay okay sambung balik. it started almost macam ni la. (i dont remember the exact dialogue OTL)

"kenapa Kuchiki Byakuya jarang senyum?"
"sebab dia kan captain. he has that kind of pride and dignity jadi dia takkan senyum."
"the head of Kuchiki clan kan. of course muka ketat D:"
"he is so handsome okay"
"true true. he is one of the strongest shinigami in Soul Society"
"but he has pink sword" (senbonzakura ;A; yknow it is le 10000000000 sakura mini blade isnt?"
"captain yang menduda"
"he never smile since the day his wife mati kan"
"HISANA"
"duda sengsara OTL"
"he never smile because he is a duda sengsara"

.......... jadi terlekat la nama duda sengsara. jadi technically we used the duda sengsara term everywhere dan mesti lepas ni korang yang salah sangka ingatkan kitorang ni borak pasal duda mana ntah baik betul kan balik perception korang xD bwahaha.

-_- tapi hari ni saya terima 2 berita buruk kot.

1. PCR saya tiada band. -_- so kena buat balik dari dna extraction which is sad. tapi takpe bukan saya sorang. my fyp sibling pun semua masalah D: ... which is sad. but sad life is scientist best friend so well i just go with the flow and redo le dna extraction. sad sad

2.

SENSEI WHYYYYYY. tite kubo sensei want to end Bleach D: whyyyyyyyyyyyyy im sad im sad. where we can find the replacement of duda sengsara if you end Bleach! TTwTT even heard rumors said that Kishimoto sensei plan to end naruto after the war arc finish (WHICH IS ALREADY ALMOST THERE TSK)....... why why. i though sensei promised us another 10 years D: i even plan to watch Bleach with my kid TTATT

Nikkichan; sensei kecik ati ke sebab kita dah belot pegi Kat-tun dan Arashi?

Photokepshen

2012-02-01T22:44:00.001+08:00

saya rasa certain orang je paham lambang apa kat beg tu 8D 8D

bitter reality

2012-01-29T17:29:00.002+08:00

.... why you wouldn't understand the rationality of me being a hikikomori and married to my laptop?

2012-01-29T05:10:00.000+08:00

I REALLY WANT THIS T^T

tsuyoku....nai

2012-01-25T00:11:00.000+08:00

Lagu Doko ni demo aru uta dari Ninomiya Kazunari giat berkumandang di headset sambil tangan bizi men doodling random anime heroes. Terasa relax padahal esok kena masuk lab.

僕らはそんな弱くはない　でも強くもないから
だから泣いていいんだ　恥ずかしいことじゃない

Bokura wa sonna yowaku wa nai　Demo tsuyoku mo nai kara
Dakara naite iinda　Hazukashii koto janai

We are not that weak　But we're not that strong either
That's why it's okay to cry　there's nothing to be embarrassed about

Gua rasa part lagu tu gua paling suka. Gua rasa la..

p/s

Happy Birthday sho chan :D

enzymology

2012-01-23T21:25:00.006+08:00

OTL WHAT THIS ENZYMOLOGY

2012-01-19T09:08:00.001+08:00

oww wait why you guise giving me very interesting idea on how to spend my 1 malaysia book voucher ahaha.

(telah diberi amaran oleh bapak sendiri, jangan beli buku kartun trololo)

Blackout

2012-01-18T15:41:00.002+08:00

i was desperate to find solution for my dna extraction and figure out "HEYYYYY WHY WE NO WIKI" LETS WIKI AND FIND THE SOLUTION.

THEN =____=

blackout wiki is blackout

why everytime i need to google something educational, akan ada benda menghalang niat murni saya.

Q_Q

BAIK SAYA PEGI TENGOK ABANG ABANG ARASHI SAYA LA. ESOK JE LA BARU PK.

aku dah abes exam

2012-01-17T08:25:00.002+08:00

yay mada owari da. so after this saya boleh packing lepas tu tarik beg dengan bergaya balik rumah dan lupakan segala kekecewaan waktu exam! /o/

dan buat posing YOSH IM FINISH GYAAAAAAAAHHHHHH and run to airport

indeed i lied.

what i wrote there are uso. LIESSSSSSSS

part exam dah habes je yang betul. yang lain OTL penipuan terancang. saya tak packing pun saya tak tarik beg pun saya tak balik umah lagi pon pon pon pon. /pon pon pon kereta kecil ku berbunyi OTL

nah. i stay here. le supervisor said, until you obtain le dna band, you stay here here here *gema gema*

dah la saya sebatang kara je kat rumah ni. tidak, bukan kumpulan kpop kara, malah santa jenama kara pun bukan.

takpe takpe. abang abang arashi, kattun, kanjani8 boleh temankan saya D:

p/s: jangan mention kat aku pasal bunyi pelik yang ada kat area area univ kita baru baru ni, aku tanak dengar wei.

emo management

2012-01-11T17:56:00.003+08:00

Lol so technically i didnt sleep well. Who sleep well during examination week.
Call me over anxious and being exxagerate, tapi memang berapa paper dah saya tak leh jawab.
D: i didnt sleep last night. but i didnt study hard either OTL. lol i did study (and alhamdulillah that last minute question actually really UWAHHHHHH like jackpot gila *cough yang HACCP tu je OTL* i lose focus. and i blame my brain for not cooperating. sigh ;~~~~~~~; what happen to me what happen.

but lol im not sleepy right now. >_> mecha kucha biological clock

roomate saya dah kemas kemas barang. dan saya tanya eh eh bila balik. she said malam 13. OTL that is HAYAII! D: D:

saya habis paper 16 dan tak tau bila balik ;A;
my life is solely depend on the dna band asdfghjkl why you no appear properly :/

tapi omedetou. congratulation sapa yang dah habis paper. TTwTT

tadi saya pegi makan kerepek sambil duduk tepi tingkap (kengkonon macam video klip lagu korea ptuiii =__=) and ahhh the weather is fine, renyai renyai (ps i am a raining person. i dislike sunlight. i am vampire you know). it was a good mood. did i ever told you that i really like kerepek? kerepek is the pride of johorean okay D: i always cherish every bite of the kerepek /o/

tetiba mood saya spoil tengok orang sorong sorong luggage. sigh

lately my mood change drastically like tsunami wave. D:

i dont have proper emotional management. it is forever a fact trololo

p/s: malam tadi saya google pollen allergies, some hypersensitivity type 1 and some keyword tapi related to pollen then ter drag drag drag pegi itu la ini la then entah macam mana saya jumpa ni OTL

IT IS RIIDA ~ OUR OHNO SATOSHI TTwTT

internet y u give me handsome guy. you know im googling some immunology related things there D:

p/s: it was fanfic; where riida is allergic to pollen. lol bahaya bahaya OTL
p/s: D: like seriously masa masa saya nak berhiatus terhadap kpop ni, ramai pulak abang abang jepun yang mengganggu hidup saya. ;_______; dah la saya tengah miskin ni. barang barang jepun semua bila convert jadi 928492899108392 ganda tinggi. cet.

bye doakan saya lulus exam.

ふくざつ

2012-01-02T19:09:00.000+08:00

le exam timetable

you know, that kind of bipolar, moody and gloomy ambiance created due to final exam pressure?. do you get my feelings? it's like 5 minutes ago you are so hyper spamming about arashi then another 5 minutes you start to cry because you dont understand any single thing about multiple dna alignments and start to emit dark murderous aura

do you geddit?

my feerings is too compricated nau.

p/s: ふくざつ ; fu-ku-za-tsu; meaning: complicated.

byebye

tak best

2011-12-26T15:00:00.001+08:00

benda yang paling busuk selalu berlaku di hujung sem adalah

1) takda duit. duit pokai. wallet ringan. kad melambak tapi kalau duit takde, takde maknenye. sape cakap duit tu sebenarnya bukan kepentingan pun memang aku tabik la wei. honestly you living in denial. kau tade duit tak makan wei. korek la almari. megi satu bungkus kat koperasi pun singgit wei. lepas tu time la hutang library hutang baju koporat hutang buku hutang potostet semua datang berduyun duyun. le sigh.

2) assigment banyak. (takpe da settle huehue)

3) last minute kejar cop kolej. sapa duk kolej dalam univ mesti tau ektibiti ni

4) tiket flight mahal. ..... nothing much to say. now everyone can cry. TTwTT

5) nota ilang. nampak sangat jarang membaca

6) DNA band tak dapat dapat - kategori pelajar tahun akhir yang hidup mati grad tak grad berlandaskan dna. =3= (tolong la doakan saya dapat ;__; i feel like dying alrdy living in that lab)

7) final exam.

kebende. tak best betul

(aku memang dalam kategori pelajar paling kuat mengeluh dah la byeeeeeeeeeeeeee)

2011-12-22T23:48:00.000+08:00

KAZU-CHAN ;~~~;

Ninomiya is left handed .

I AM LEFT HANDED TOO.

technically in genetic term

left handed person is rrrr

and right handed person has probility of being RRRR or RRrr

=w= if both of us get married, then it is going to be rrrr x rrrr

and our babies will be rrrr rrrr rrrr rrrr ........................ huehueheuehueuehuehue

NINOMIYA KAZUNARI. LETS GET MARRIED AND PRODUCE LARGE COLONY OF LEFT HANDED BABIES TOGETHER

................gomen, saya merapu. ah. well what to do. people around me keep talking about kahwin D: i dont know how to relate it....

~~is it fun to fall in love? because last time i did, it hurt a lot lol~~. zenzen tanoshikunakatta desu.

ORAIT CASE CLOSE. OTL

well... today is the saigo no hi for our nihongo level 2 no kurasu (kelas terakhir bahasa jepun level 2). meh, it was awkward, sebab saya dan afrinyan bangun lambat. lol boleh imagine dua orang yang hidup dalam dunia yang sama, stan arashi sama sama tapi duduk rumah lain lain bangun waktu lebih kurang. no no, actually amirul kejut kitorang OTL. amirul bapak baik weis, kalau kitorang lambat mesti anta mesej "korang kat ne?" "korang tak gi kelas ke" TTwTT first time aku rasa omg memang best dikelilingi otaku, arashi otaku, manga otaku, game otaku ;w; bahagia. YOU DONT UNDERSTAND OUR WORLD ;A;

kelas jepun kami pukul 8 pagi (jepun maybe memang suka mengadap matahari terbit kot. sebab tu kelas pagi pagi buta). and this morning we woke up around 9 and arrive at class around 920 and sensei laugh at us "ahhhhhhh osoi! only 30 minutes left"

trololo. terus hilang kelayakan nak jadi japanese sobs.

but sensei is so good ;__; she said ahh daijoubu desu. take your seat onegaishimasu. haihhhhhh.

5 minutes before the final class ended, sensei actually request us to .. well, share anything that we have gain thru out this semester in her class. lol i swear, i feel like crying.

no.

not just me.

but everyone in the class.

maybe sensei too.

IT WAS HELL FUN OKAY. the only class that i truly feel happy happy ureshiiiiiiii /o/
(being in lab is ureshii too but =3= ... ah iro iro no kimochi /cough

it was crazy to take this class. lol. to think back that every tuesday some of us need to enter le class satu jam lambat (sebab kelas clash. my subject core and nihongo no kurasu) was awkward and dangerous decision enough.

sampai turn saya punya hitokoto (=_= technically bukan hitokoto pun. orang lain semua cakap ayat berperenggan perenggan) ...idk. speechless ;~~;

ah finally saya cakap saya minta maaf sebab selalu lewat datang kelas, selalu lewat hantar shukudai, selalu lewat datang assessment.. TTwTT wuu.

sensei actually laugh at me. /o/ i shall be famous for being ICHIBAN in so many weird and bad things hueheuheuehueue.
but then she replied. "ahh mondainai... aimi san has improve a lot"

sobsss...........

kau orang ingat tak masa kita presentation proposal. it was the day my 2nd oral assessment. honestly i did bad. lol siapa boleh focus dalam masa stress macam tu. i only score 5/10. meh you can expect me to cry niagara falls alone bawah selimut. Only Aida senpai know ;_; (since i tweeted her ;__;)

however. alhamdulillah :'D i did quite well in my 3rd and 4th assessment /o/

i dont really target to score A pacak (but if it do, uwahh it is so naisu ;w;) ... let see what happen during final exam later. but hontou ni, i just want to do my best asdfghjklasdfghjklasdfghjkl

ahh. what happen to me.

kbai.

2011-12-21T01:12:00.003+08:00

1.10 AM

location : microbiology lab.
/o/

2011-12-19T01:42:00.004+08:00

一体何をしているんだろう
一体何を見ているんだろう
一体何に来ているんだろう

"僕はもう…"嗚呼もう走馬灯のよう
小さいプライド守る為
誰かを不意に傷付ける
昨日も今日も今日もそうだろうが今日は今日でどうかしよう

頭上に悠然とはためく、漠然とした
夢を掲げ
この道の先はまだまだ見えず
失敗からしか何一学べず

空の向こう越える為のこの人生の抑揚
あの頃の未来向かい時代に期待せずも
進む my life

2011-12-16T03:54:00.001+08:00

I maybe start to really like Arashi a lot D:

Gerhana mata hitam ku

2011-12-11T20:50:00.001+08:00

=_= saya tau ada gerhana tapi saya tak tau tarikh dia bila dan pukul berapa (ingatan ketinggalan 30 tahun cahaya kebelakang) .

IT WAS YESTERDAY OTL. (ノ｀m´)ノ ~┻━┻ (/o＼) /tebalikkanmeja

i was busy (aku terlibat dalam sesuatu program. tengoklah kalau dah berjaya nanti baru gebang dalam blog (kalau rajin lol tapi ~~biasanya memang tak rajin~~.... lol))

and........ i saw ieyra's friend twit about the moon getting red D: D: D: and i start to feel asdfghjkl..

gambar kebas dari lebai google D: Subhanallah

i missed the red moon D: BOKU NO PURAIDO ARE SHATTERED.

IM NO LONGER A LEGIT AKATSUKI MEMBER

madara and saskey will disown me TTwTT

p/s;ah saya gurau je. takde kaitan pun fenomena alam dengan madara. (but do you still remember this moment? ....)

Naruto 467 - Madara's Eye of the moon plan D:

p/s: and.... yes.....


TTwTT

ALL IS WELL. /LIESSSSS

2011-12-03T23:53:00.001+08:00

alhamdulillah.
henset dah keluar ward. kerosakan dalaman berjaya di fixed kan dan menelan hundred something . and the taukeh actually ask me,

"ah your cover ni tak mau ganti ka? ada patah sini"

ABSOLUTE NO OTL. i cant afford anymore.
ah takpe, stylish ape pakai henpon ikat getah. kau ade? you jelly? touch screen is too common okay /flipshair *tsktsktsk

ah well. saya kena tulis progress report sekarang. =__= what is lifeeeeeeee.

p/s: tq ili, sm nadiah, laila .
p/s: muhsen is in the same boat with me. *pat on le back

UPDATE:

I DONT KNOW WHAT TO WRITE IN PROGRESS REPORT AND WHY WE NEED TO SUBMIT THIS ON NEXT MONDAY? ASDFGHJKLASDFGHJKL

2011-12-03T00:50:00.001+08:00

=__=
cologne tertumpah dan baru sedar. dan baru sedar yang cologne tumpah atas henset D:
cologne is a perfume isnt. perfume is an alcohol. D:
SO
technically my phone happily soaked in alcohol.

aku memang ada badi, yang tiap tiap tahun henset rosak
sebab tu tak pernah peduli pun orang pakai ipong ke blekberi ke sebab memang sedar ketidak upayaan diri sendiri nak bercermat dan berhati hati dalam setiap tindakan.

i dont know what to do anymore
*lock self inside microb lab*
kbai

Berjakun jakun wishlist

2011-11-27T05:29:00.001+08:00

Awesome :'D

THESE ARE SEVERAL THINGS THAT WE NEED TO ACCOMPLISH NIKKINYAN, AOSHINNYAN, INTANNYAN.

1) masuk toilet dan bejakun jakun.

2) pegi 7E (;A; PEOPLE GO GO WATCH AAA 7E ENDORSEMENT CF and go aljkdskakdajkdsa. D: D:). masuk 7E dan berjakun jakun (high probability of buying many things here)

3) find vending machine dan berjakun jakun.

4) naik train himpit himpit macam dekat manga. (=__= tapi taknak la tiba tiba ada watak lelaki separuh umur botak pakai spec jadi peraba OTL)

5) melintas shibuya cross, berjakun jakun dan jerit I'M HEREEEEEEEEE.

6) stalk bangunan JE (=___= NIKKI. FOR THE SAKE OF UEPI, TAGUCHI, KAME, KOKI AND MY AWKWARD MARU)

7) Visit Harajuku (NOT SURE IF WE ABLE TO SHOP. kalau mampu ;__;)

8) Snap picture with random nihon jin (ni akibat terlalu jakun)

9) Amik gambar segala gala nya. (Even gambar butang flush dekat toilet pun akan ambil jugak)

10) Fully converse (dan 50 % mengarut) dalam Nihongo.

11) Dengar radio jepang dan bejakun jakun.

12) Serbu music store dan berjakun jakun (=___= sebab album jepang susah nak cari kat sini dan kene order dan sebab tu poket selalu tebakar sebab kena bayar tax =______=)

13) SERBU KEDAI MANGA DAN DAN... _____________ sambung sendiri (The manga must be all in Nihongo isnt but but, for weird girls like us, it was, the last problem. Yang penting dapat peluk cium original manga TT_TT)

14) Tengok jdorama / anime dekat tv (sebab takde subtitle jadi ini lebih mencabar :'D silap silap drama 2 jam, satu dua ayat je aku paham)

15) EAT. EAT IS A MUST. MUST EAT NIHON NO RYOURI UNTIL GET FAT. GAIN WEIGHT IT'S OKAY IT'S OKAY. sarapan, makan tengahari, makan malam full japanese xD

16) Fujisan ni noboru. ZETTAI NI. sampai atas jerit "I'M HEREEEEEEEEE" (sekali lagi) then duduk kejap mengingati masa lampau sedari kecil sampai besar. (nak menangis ke mengaji ke. it's optional OTL)

17) Beramah mesra dengan local people (+ increase the possibility of meeting future husband)

18) Ride le famous Nozomi or Hikari or Kodama or Sakura or Mizuho or or *forget le name* but but, yessss ride le famous shinkasen =w= dan berjakun jakun

19) Sebelum naik Shinkasen, maybe berjakun jakun dulu beli tiket kat mesin elektronik OTL

20) Ambil gambar dengan abang GUNDAM SAYANG dan berjakun jakun.


SO BEAUTIFUL SHINING LIKE ANGEL ;A;

KAU TAK RASA INI SANGAT COOL KE. TTwTT saya harap belakang rumah saya ada patung gundam gedabak macam ni. seriously seriously. TTwTT i probably crying bila sampai depan ni. (maybe menjerit I'M HEREEEEE sekali lagi TTwTT)

21) Melawat kampung ninja . (somewhere at Nagano i think ;A;)

22) Berjalan jalan sekeliling memakai yukata (D: oh this is if in case we come during le summer)

23) Membeli sesuatu yang mampu dikenang sampai bila bila. Something awesome.

Scene 1:

Nenek: Uhuk uhuk uhuk cu, tengok ni.. ni nenek beli masa nenek backpacking pegi jepun dulu uhuk uhuk
Cucu : *mengurut ngurut bahu nenek* seriously? nenek dulu pegi backpacking pegi Jepanggg? bapak cool gila nenek aku.

Nenek : Mesti la. masa tu la nenek jumpa dengan atuk kau

WAHKAHKAHKAHKAH.

kbai

p/s: ;A; now you know how obsessed we are

Macam mana la saya tak sayang

2011-11-27T01:27:00.001+08:00

;A; SO ALAKSFJKASJFAKGHJH ISNT D:

btw selamat tahun baru. i celebrate my new year watching running man alone (ㅜㅜㅜㅜㅜㅜHOUSEMATE ARE ALL GONE. ROOMATE TOO)

but (￣▽￣) I HAVE LAPTOP IM NOT ALONE MWAHAHA .kbai

Post Apocalypse

2011-11-23T20:11:00.001+08:00

ohai everyone. apa khabar? khabar yang penuh dengan dusta sengsara. OTL

im good im good.

saya baru balik dari makan makanan yang mewah macam orang kaya kaya. sebab tu mood saya baik 8D 8D 8D mood instantly fixed with le foods.

OH YEAH REMEMBER MY WILD WISH LAST WEEK.

5. The near-future wish: I hope i can finish studying Bioinfomatic and Enzymology (since le exam is next Wednesday and i was somewhere around LU2) fuuu.
.....

yessss sebenarnye kiteww dapat study habisss then kiteww dapat jawab exam dengan baik sekali. yay A dapat gengaman. nanti kitewww dapat A awak belanje kiteww mamam kepsi yewww.

LIESSSSSSSSSSSSSSSSSSSSS IT IS A LIESSSSSSSSSSS. LIESSSSSSSSSSSS.
=___=

weh kau tau different habis baca dengan habis selak.
kalau habis baca mesti lah dapat keluar awal then dengan konpiden cakap "hm.. soalan 7 jew kite tak tau buat" dan annoy kawan kawan sekeliling. ATAU. siap jawab awal dan dengki kat budak budak tak habis jawab lagi, sengaja pegi tandas 5-6 kali. terlalu banyak masa. =____= easy like peanut

tapi kalau habis selak je

"WOI MATI LA. 1 JE AKU RETI. YANG LAIN AKU TAK TAU. KAU TAU BUAT?" *tips: ayat ni jangan la pegi cakap kat budak dean list 4 semester, nanti engkau yang rasa annoyed balik.. kene cakap dengan orang yang setaraf.. sekedudukan .*

dan rasa lega bila ada orang support
"DONT WORRY BEB. AKU JAWAB 1 JE YANG LAIN TINGGAL"
"DONT WORRY KITA FAIL SAMA SAMA EH"
"AJKDAJSDJKASHJKDHAJKSHADSJKHJADS GELAP MASA DEPAN"
"BERKABUNGGGGGG. PAKAI BAJU HITAMMMMMMM MULAI HARI INI"

ape orang kate, moral support =______= OTL.
~~by the way. i have faith on my enzymology~~ (atas sebab misteri) tapi untuk Bioinfomatic, jom terjun bangunan. ya. aku sepatah haram memang tak paham lansung apa kehendak soalan tu. maklumla selama ni main software, kopipes nucleotide / protein sequence lepas tu paste dalam satu lagi generator then tadaaaaaa keluar sequence. D8 TAPI SEKARANG DIA SURUH CARI SENDIRI 5'-3' 3'-5'. TAKDE SOFTWARE SOFTWARE NCBI, DDBJ, EMBL TAKDEEEEE. manual. manual der.

mata berpinau tengok sequence AAATTTTCGGATCCGTAAAGGTCGCGTGC =___=

=_____= i just want to pass. please. TTwTT
kbaiii

2011-11-21T13:30:00.001+08:00

People around me discussing about le enzyme thingy and i am like

FML.

DAI DAI DAI

Wishes

2011-11-18T14:13:00.001+08:00

(copy paste this from nikkinyan kehkeh.)

Making these wishes because I CAN.

1. The childhood wish: I have two dream when i was young and hopeless. First, i want to be a mangaka D8. I want to draw, but since my mom said "ok that job wont lead you to a proper life. mom and dad want you to become a Dr or Ir or etc etc *typical parenthood punya ayat*. I kinda flunk my 1st dream. 2nd, I want to be F1 engineer. =__= dude, i was a hardcore F1 fan back in school era (Kimi Raikkonen clan since 2004). But since i am hopeless in math and additional math, let just forget this.

to think back all these. and seeing how divert i am today from art and engineering field (D8< IMMA BIOLOGIST RIGHT NOW), may fate lead me to a better life TTwTT

2. The selfish wish: A fat bank account. Young and rich.

3. The clichéd wish: MARRYING A JAPANESE/KOREAN/CHINESE HANSAMU GUY. or someone like Cho Kyuhyun OTL Yeah. Kyuhyun is special. i dont know how to explain this.

4. The noble wish: My saudara mara can stop quarelling between each other. T.T lol family matter but young generation like me dislike this. ~~(or basically we dont really bother pfft)~~

5. The near-future wish: I hope i can finish studying Bioinfomatic and Enzymology (since le exam is next Wednesday and i was somewhere around LU2) fuuu.

6. The before-I’m-25 wish: Graduate with phD in microbiology? KAHKAHKAH. Go to Japan with my nakama. Manage to be really fluent in Nihongo. MEET JANG DONG WOO, ZHOU MI AND CHO KYUHYUN. Find a proper man for marriage. (=_= but that is another story OTL)

7. The life-experience wish: Backpacking around Nippon! :3 Honshū, Hokkaidō, Kyūshū and Shikoku ~~ exploring all the places. Maybe saya buat wish macam Nikkinyan la kot. Pergi mendaki Gunung Fuji, then sampai atas duduk termenung reminiscence balik kenangan from childhood sampai sekarang. Then scream, I DID ITTTTTTTTTTTTTT!!! 8D

8. The technological-advancements wish: Hmm. Since i watch too many Doraemon, there are a lot of weird gadgets in my imagination. lololo. Pintu Suka hati is the best Doraemon creation ever.

9. The self-improvement wish: Less emo. lol xD

10. The close-to-my-heart wish: To be able to become a good daughter. OTL

11. The last-but-not-least wish: Everyone will be happy 8D

p/s: dont laugh at other people punya dream .

Hidup bermasyarakat

2011-11-18T03:21:00.001+08:00

"ye..faham..hidup bermasyarakat~orz orz..hv to bear with that though." Didi, 2011

"saya rasa saya banyak makan dalam je. awok je la dengar ape saya cakap"
"tapi saya pun same"
"elok le kite berdua." Eda, 2011

kahkah.

hidup bermasyarakat.

hidup bermasyarakat.

hidup bermasyarakat.

IT'S FUN *sarcasm*

LIESSSSSSSSSSSSSSSSSSSSSSSSSSSS BYE

p/s: this is random. but i really want this album. anyone anyone? /o/

p/s: this really made my bad day today
"The last country to travel would be Japan and I shall reminisce all my memories (childhood till present) at the top of Mount Fuji and shout "I DID IT!" :D" - Nikki chan *gelak golek golek WHY FUJISAN? WHY xD*

2011-11-16T16:29:00.001+08:00

... exam is fun.

TTwTT

たのしいですね。。

laptop buat perangai (kot?)

2011-11-13T03:41:00.001+08:00

aku tatau ar. masa 1st dia main mati mati. time tu petang lepas proposal presentation. pergh. dah la wey stress memuncak. 1st temati, memang mengalir air mata.

2nd...

3rd...

lelama malas nak layan.

1st figure out maybe overheat. maybe laa. sapa final year mesti tau, laptop kau on sampai dua hari pun normal ;_;

2nd, 3rd, figure out masa tersepak adapter. lepas tu dia mati. oh rupanya adapter yang masalah.

idk.

ayah gua dah suruh swap laptop dengan dia punya. tapi, kau kena paham. laptop remaja yang sihat memang bergiga gigabyte penuh dengan perkara perkara yang melagha kan.

D8< kpop stuff. anime stuff. =__=

da la aku malas nak komeng pape. laptop. kalau rasa nak mati, tunggu aku habis assassin clan listeria monocytogenes dulu ok? kbai.

Well...

2011-11-10T14:36:00.002+08:00

I'm glad not only saya yang gila. D: OTL

WHO IS THE KAMEN GUY WHY HE IS NOT UCHIHA MADARA. BUT HE MUST BE AN UCHIHA BECAUSE HE HAZ THE SHARINGAN. ;_____;

(p/s: the long haired guy is madara ;A; sharingan, mangekyou sharingan, susano-o, then rinnegan and and OTL OTL)

TWISTED NARUTO STORY TROLLING MY HEART,

p/s: you know i am uchiha bias isnt? :D (walaupun saya tau clan uchiha memang jahat =w=)

=_=

2011-11-08T18:29:00.000+08:00

kamon naruto kamonnnn

banyak lagi wanita diluar sana. mengapa filler bodoh ni nak jugak highlight kau suka sakura =_______=

kamon. HINATA WEY HINATA. ~~(ke sasuke ke)~~

le kpop invasion

2011-11-08T17:55:00.002+08:00

You know kpop?
D: naah not kelantan pop (my former supervisor masa zaman intern dekat upm once joke said, eh saya pun dengar lagu kpop dan jpop. kelantan pop dan johor pop *kitorang dah barai barai gelak kan dia dah xD* =____=)

akak master kat lab saya dia suka dengar lagu kpop, 4 minutes to be exact (sampai dah hafal wei =v=). speaker PC tu sebelah peti sejuk tempat kami simpan culture agar. (salmonella spp there. got listeria spp there too. vibrio spp. too OTL)

bebudak pominit

eh, anybody want to do research? did any metabolic changes occur at the bacteria sebab hari hari dia dengar lagu korea kot xD. multiply rapidly in low temperature due to kpop song? bwahaha xD did i inspire you to related something educational with kpop?

NAH SAYA MERAPU JE NI. KBAI.

p/s; T_T kan bulan depan kan ada concert kat KL kan? ke bulan ni kan? ;_____; sedeih. i never attend any kpop event. ili. ili baik belikan gambar kyuhyun sebagai pengganti ;________;

raye wei raye

2011-11-07T17:50:00.000+08:00

hewhew. as expected, from the best captain, Kuchiki Byakuya =w= kapten saya sangat mengambil berat kakitangan shinigami dia =v=

okbai.

Selamat hari raya aidil adha

2011-11-06T06:12:00.002+08:00

No i didnt return home for raya.

stop asking -_-

Last year, during chinese new year, i didnt go back to hometown too. the situation is similar. feels like dejavu aceyceyh. well, last year i was a bit immature (WELL COMPARE TO THIS YEAR HEWHEW). i went emo and vent all my anger . well i was 19 last year D:< i was emo since i fail to get tiket murah from AA hoho. -_- what was life. as a result, i lock myself inside my room for 3 days and watch anime, facebooking and play plant vs zombie non stop =_= (the game was really in and tip top in my campus last year D;)

well.. it was not something that you should be proud to, but whatever, if my children ask me in the future, im going to be the coolest mom =_= locking herself inside the room because didnt manage to get cheap AA tix. what kind of mother is that OTL.

but but :3 this is year, no more emo. fufufu

AAA

and stop asking how im going to spend my holiday.

i didnt plan anything.

shikashi, after a few weeks dealing with fyp, assignments and weird tesuto, i take this holiday for another short break (lets not think about what will happen next week and another next week and another next next next next week when everybody feel emo again shall we? :D)

im going to sleep happily :D roomie is kinda busy with her own schedule so theoratically im alone in the room. >:D ROLL HAPPILY.

hibernate mode :D :D :D :D /ignoring the notes.
selamat hari raya

for the first time i really want to have happy holiday. (or at least happy sleep session 8D)
kbai.

Study + dying = Studying

2011-11-04T09:50:00.003+08:00

I cant believe the molecular biology notes are actually friggin too many okey D:

AND SUDDENLY ALL THE DNA SPLICING CAPPING POLY A TAIL SOUND SO ALIEN TO MY BRAIN.

=_= trust me. im only flipping my notes right now.

i am preparing myself to die. so soon. pukul 3.30 petang nanti. kbai

IT HAS BEEN SO GOOOD

2011-11-01T18:52:00.000+08:00

IT HAS BEEN GOOD.

LIESSSSSSSSS

THE STATEMENT ABOVE IS THE MOST ABSURD LIESSS EVER. /terjun bangunan

ow ow.

first and foremost, thank you Allah TTwTT

today, 1.11.11 , was supposed to be my best day.

everything when quiet moderate (˘_˘") but above of all like i said earlier, alhamdulillah :3. it's like 50:50 fuuu, still i am grateful enough, because compare me to others, i am.. liek in the middle. sobs. i no excel no bad. i am in the middle invincible as always. (YEA =____=)

D: my session start at 9AM. i am the 3rd presenter after sein and amirul.

awal awal pagi TTwTT my half shut down brain didnt even manage to reboot yet sobs. (bajet otak windows 1995 ke hape nak main reboot reboot TTwTT)

D: i hate presentation for whatever reason i am really afraid to talk in front of le crowd OTL. dah la ila pagi pinjam kasut heels dia. pergh baru aku tau feeling tinggi orang 170 CM OTL dan kau tau, da la pakai heels, lepas tu jalan nak pegi fakulti kitorang dah ar bukit (depan sakura), cilakaaaaaa. apsal aku tengok SNSD, KARA SENANG JE PAKAI. haih TTwTT /tarik slipa jamban gambar kakashi TTwTT. maa. well the presentation went quite well. my ex roomate actually drop by to witness (CEH WITNESS) my presentation, TwT sobs. banyak banyak roomate, roomate last year is the best TTwTT. teharu teharu.

well. =_= mana ada presentation yang takde kene tembak fuuuu.

1st question. "what is le symptom of human infected with listeria monocytogenes"
*soalan first kasi gua feeling gaya gua ni budak medic lu tau hewhewhewhew*

alhamdulillah, i actually hafal simptom simptom :3

2nd question. dari dr yang hensem dan cool D: and and i classified him as handsome not because his face (but trust me, he is in his early 30 fuuu kekeke), but actually masa last week, dia masuk kelas kitorang ajar enzymology (it's like the 1st module Dr lain ajar. then the 2nd half of the module Dr lain ajar). ANDDD WHY I SAID HE IS SO COOL. he was like, enter the class and introduce himself. then he took the marker pen and wrote "生命工学" at the white board. i was like ..er.. =_= saya tak reti baca semua. satu kenal "sei" "kougaku" kat belakang . and and btw it's seimei kougaku isnt D: life engineering. uu. and he said, i come from engineering background however i switch to bio during my master and phD because IN BIO THERE ARE MORE GIRLSSSSSSS. however i suffer a lot since i hates bio and need to learn it from basic oooo. but basically he was like the true japanication product D: D: D: from degree to master to phD all made in japannnn THATS WHY I CLASSIFIED HIM AS HANDSOMEE OTL *incoherence answer* (P.S HE IS KIDAL TOO OTL I HAVE PRIDE TO BE A KIDAL /COUGH) . -_- haih expensive. what an expensive dude.

ok back to the main story. hoh. so he actually raised up his hand and ask me
"Do you think it is worth it to RISK YOUR LIFE studying this pathogenic bacteria"

and i was like =____=

and he added.. "because you are dealing with wildlife and.. you know, your life.. and this kind of transmission"

TTwTT haih this dr is so cool leh TTwTT i shall study enzymology harder after this TTwTT

=_= well then i answer him, like prevention and langkah bejaga jaga will be taken. then since lismon (nama manja listeria monocytogenes, yeah Aida senpai create it for me) occurence isnt fully documented in nature, so that's why i choose this title. however, i will try to be careful and bla bla bla TTwTT

TTwTT dude. dont freak me out. i havent reach japan yet TTwTT

the 3rd question.. =_____= was akjdkadkasjkldasjkdasjklsjakljdklasjksajkasjksajklsajkjksa

"why the lismon is name as listeria monocytogenes"

*bunyi cengkerik*

"i give you a clue.. neutrophils"

i was like D: D: but my topic is microbiology and wae you ask me about immunology. i know, immunology and microbiology is sedara. but but I DONT KNOW TTwTT

i was like randomly blurted.. "monocyte... "zzzz

and the prof actually smile andddddddd.. ASK ONE KILLER QUESTION.

"HOW IT ATTACKS FROM CELL TO CELL"

akjdsklakajakljkjkdasjk that is so immunology. TTwTT my relationship with immunology is difficult. i love immuno but immuno hatesssss me.

I CANT ANSWER LE QUESTION TTwTT

=_= And lepas tu saya rasa sedih sikit. tapi tak sedih sebab i saw most of my colleagues yang dah kena tembak pun muka kental lagi and some of them actually talk to me *try to comfort me* keke 8D. believe me friends, i am inspired by each one of you . THIS IS SINCERE.

then my former roomate approach me and said ahh everything is okey, just the last part D:
but whatever.

she lend me her phone for a while (about 15 minutes) and saya pegi main angry bird dan menang beberapa stage muehehe. so i is no longer sad. hewhewhew

okbai.

P/s EXAM AND ORAL TEST ON KINYOUBI DESU TTwTT wish us luck!! kbaiii

If your friend still befriended with you, even after the worst karaoke session. Then trust me, he or she is your true friend.

2011-10-27T21:47:00.001+08:00

-_- quote dari lecturer enzymology yang hensem.

Kerlasss kau jah!

2011-10-20T11:58:00.000+08:00

hari ini hari khamis :D saya paling suka hari khamis dan hari selasa sebab ade kelas nihongo.
even though kelas pagi pagi buta pukul 8 kan (=_= jepun memang suka mengadap matahari la kot?)

-_- hari ni dapat tulis karangan nihongo satu dan setengah muka surat dengan afri. (one and half pages?) gitu le.

selama ni nak dapat 1 pun menyumpah =_= sambil tulis sambil makan biskut oreo depan sensei xD

yeah aku memang gigih belajar bahasa ni -_- kalau dapat naik mesen doremon, dah lama dah aku discard medic, biotech pekejadah ni. silap silap kalau dapat rewind balik ,pas pmr terus amek art je. bio pizik addmath tu duniawi je semua *wakakaka

hoh tapi takdir wei takdir. kene gak begaduh dengan microbe sepanjang hayat. takpe wey jangan besangke buruk kat Allah :) at least sekarang boleh belajar dua dua. multitasking multitasking ^^

yeah kene positif, mana tau impian nak mengorat Nihon Jin yang kakkoi macam ini tercapai

baik kau amin kan ayat aku yang kat atas ni. ok dah la bai.

-_- lapar la pulak taip taip proposal ni

2011-10-19T01:25:00.000+08:00

ESOK SUBMIT 1ST OFFICIAL DRAFT. DOAKAN DOAKAN DOAKAN SAYA KBYE

Meow.

2011-10-15T21:01:00.000+08:00

T^T no saya tak jadi tengok naruto so ignore post lepas. *depress*

bye

Osashiburi desu yo~. Before that, it's been a month i didnt watch Naruto Shippuden. This is sick. Let's ignore the fact that i am procrastinating for today. Im going to watch Naruto like boss right now ToT /ignore the proposal and assignments. Im doing it. BYE

2011-10-15T14:48:00.000+08:00

Danger

2011-10-08T15:47:00.001+08:00

Yesterday during Bioprocess no kurasu, the professor actually told us about his personal experience during his student life. There was a moment when he still in his postgrad laifu (i think.. =^= pardon me if i misheard it lololo i blame my asian ears), his life was no different than what im having now . lab. lab. lab. emo (ok obviously this part i added it by myself hewhew) During that time, his lab was quite near to another lab which conduct research on Ascaris.

Ascaris is worm, idk what its malay name but if you do have time, do google about it (AND SEE THOSE CREEPY IMAGES APPEAR ==" YOU HAVE BEEN WARNED BY ME). Well, basically, A. lumbricoides is the largest intestinal roundworm and is the most common helminth infection of humans worldwide, an infection known as ascariasis.

There were three researchers who study ascaris extensively (i dont remember the details but le professor said they are studying on how the ascaris's egg actually can survive in harsh condition at longer time TT3TT), 2 handsome guy, A and B and 1 beautiful girl, AA.

*put Doushitte kimi wa suki ni natte shimattan darou from DBSK as background song* Well yeah let the korean drama begin now. Apparently the A guy actually fall in love with AA girl but AA girl refuse to accept his pure love and turn to like B guy more. Sound like typical k-drama isnt? BUT WAIT. HEWHEW. EXPECT MORE TO COME; ARENT SCIENTISTS LIKE US ARE FREAK AND WEIRDO D:

Then the prof continue his story.

One day, these trio went for short coffee break at pantry nearby. Here come disaster. The AA girl didnt realize that actually her milk was contaminated with ascaris egg. FREAK ISNT? ~_~ the A guy actually put that dangerous tamago inside her milk. The girl drank it and eventually died because of the chronic ascaris infection in her intestine and my prof said, till her deathbed , they still can see ascaris moving somewhere in her eyelid OTL. D: WHAT IS LOVE. WHAT IS LIFE? WHY THIS IS TOO SCARY? OTL.

(image courtesy of lebai google)

Lol then cikot actually ask me silly question, which one is more interesting? sending SANTAU to people you hate or put ASCARIS egg at their food? or ethidium bromide? you know the one that we used in AGE? PFGE? OTL OTL WHAT WITH THIS MURDER INTENT AKLDJAKSDJSAJKASJKAS OTL.

>_> but but you know....

actually, i was so emo last wednesday.. and tweet something like this

and... this tweet was posted 2 days before i hear this ascaris story

OTL

(BUT I DIDNT MEANT IT. this tweet is just.. an emo tweet. =____= tidak melibatkan baik yang hidup atau yang mati this is just an emo tweet (but i no longer emo at le evening since i met somebody at One Stop Shop and suddenly that shop actually put Super Junior's "NEURAGO" song and and. omg dramatic dramatic)

=_____= but but dont take wrong but guys, if you plan to marry scientist like... us~~ beware.. hewhew. bye

Neko

2011-10-07T00:09:00.000+08:00

xD actually, i really like this cat :3 *pat pat* xDDDD

SHE IS HILARIOUS xDDDD

bye

2011-10-05T13:11:00.001+08:00

i are sad
you dont know how sad i am.
you just dont know. bye

Perut didahulukan, proposal dan nota kuliah dikemudian kan

2011-10-03T13:53:00.001+08:00

yesterday was indeed a perut boroi day.

afternoon we had our プライベートタイム with our gene gun expertise sensei (kekeke) madam safa :) ze foodies are awesome and i are fat. i eat everything. OTL nadiah said ok this is free food we need to sental it. we need askljdskadskladsjka xD

:D ah this jamuan raya was prepared awesomely by madam safa sekeluarga :D wee~~ tq tq tq. (walaupun tak dapat A subject PAB akdjajaa =___= ) then we manage to meet our adik baru (hewhewhew), madam newborn baby. omg comel gilak ok (tapi lupa nama dia siapa D: D: D:) i was like.. zomgggg this あかちゃん is too cute i cant handle cute thing but baby is not a thing, it's a live organism with double stranded DNA (OTL) *dukung baby kejap* awww aww she is so soft and innocent and she stare at me (while im eating pisang =_= well i is busy eating while playing with baby /cough cough multitasking what you call xD) BUT BUT SHE IS ajkjskajasjksa CUTEEEE /divert attention with food.

BABY, PLEASE GROW UP INTO BEAUTIFUL WOMAN AND BECOME A COOL PLANT BIOTECHNOLOGIST LIKE YOUR OKACHAN OK OTL. /positive hope from your distant sister *tetibe mengaku*

-_- and suddenly i miss my 3rd brother *during his baby phase, he is so cute. he is always sleep and and and akjdklajkasjksajksa coo happily when i teased him , such old day during those times /crey* now he is already a kindergarten student and he lose all the cuteness inside him dan rasa nak sepak je time dia mengada OTL

. time, why you so cruel to me xDD

maa maa. during le night, our univ actually organize festival aidilfitri. so expect more foods available. wehehe. free foods bring joys to our scarred heart *ayat bermadah*. yeah. me and nadiah really love free food OTL.

okbai.

P/S: credit to almuhsen for the picture. xD

2011-10-01T16:44:00.000+08:00

(¬_¬) dont read my blog and dont follow my twitter account if you are a judgmental person. WAYLT

Semalam hari yang tak berapa bagus

2011-10-01T05:41:00.000+08:00

Siryes semalam hari yang agak malang untuk aku dan eda TTwTT

pegi balai polis yang jauh gila. lepas tu balik univ. lepas tu kena marah dengan PA timbalan dekan. sesat dalam lecture room OTL, then pegi pejabat imegresen. kena marah lagi sebab tak bawak gambar dan salinan ic. then datang balik kat kaunter number dah habis TTwTT, then nak carik jpj tapi jumpa pejabat pos, then tanya pakcik depan pejabat pos kat mana jpj, lepas tu pakcik tu kurang dengar kot, orang tanya jpj dia bagi jalan pegi JPA TTwTT, lepas tu sesat. lepas tu give up terus singgah mekdi. lepas tu otw balik univ, ada lori ni bawak pasir, lepas tu pasir tu terbang terus mandi pasir tengah tengah jalan wuwuwuwuwuwuwu

p/s: tapi masa makan mekdi, belakang kerusi ada 1 group Nihon Jin omg. a,skjkajkajkajkjk hensem and and and i was like impressed meriahnya diorang beborak OTL. tak ke bangang impress kat orang jepun yang becakap jepun. D:

p/s; ila tak jadi amik b. arab 2. dia amek jepun level 1. bukan aku yang pengaruh dia xD lalalala~~~

dah la bye

Oyaji no danna!

2011-09-27T11:01:00.001+08:00

27th September

Happy birthday 48th birthday papa!

p/s: i resemble my dad a lot. in term of looks and failure in expressing our heart content hewhewhew.
bye

Pergi

2011-09-25T13:35:00.001+08:00

Hoh roomate ketiga gua dah pindah bilik satu lagi. kehkeh.

keadaan aman kembali lebih aman woot woot :D. just tandas je la memang hampeh. by all means sebenarnya tandas tu boleh pakai tapi gua rasa gua compatible lagi dengan tandas rumah jiran sebelah so papehal gua memang pakai teknik ninja ninja serbu toilet dan bathroom jiran sebelah je ah. jiran pun dah kenal pasti, asal budak ni masuk, mesti takde reason lain dah. toilet he ikimasu ah tu. keke.

sebab gua memang takleh tolerate ngan imej imej tandas kotor sebenanye (D: NOTE THIS)

takpe. dah nama pun ninja.
kekeke.
alhamdulillah. :D gua nak bereskan karangan kazoku yang idle dari malam tadi ni hewhew bye.

p/s: semalam gua organize party sushi kehkehkeh. oishii yo xD

絆 (Kizuna)

2011-09-24T18:44:00.001+08:00

Lagu background: Yasuharu Tanahashi - Samidare

Kalau dibanding kan hidup aku dengan siri cerita Naruto, aku memang letak diri aku sebagai Uchiha Sasuke. Sasuke kuat, tensai, tapi sasuke selalu tak appreciate kawan sekeliling dia. Unlike Naruto. (Sakura D: no comment)

Still remember about my old post? D: about my 1st year room mate? yang isap rokok tu? well, if you want to do revision, stalk la post lama lama masa aku 1st year dulu. sekarang aku dah 3rd year. (malas nak korek balik post lama sebab geli tengok mutu penulisan sendiri =____= ewwww sumpah retard habis isu isu yang diketengahkan OTL)

Roomate lama masa 1st year, such memories. Aku fail untuk form any bond dengan dia -_- basically we dont talk really much, except, hi, pegi mana and exchange smile. but one thing i do respect her, she never interfere with my stuff. D: but i still fail to actually create apa apa bond dengan dia. it just on the daily basis as roomie. covalent bond, ionic bond, london double double bond, polar bond, double bond triple bond (kejadah chemistry D:), james bond? OTL. no. no kizuna at all D: (Kizuna is "bonds" in nihongo)

takde la. just teringat menda ni sebab tadi keluar kejap dengan sm nadiah. borak borak then sm mention pasal ex roomate tu, tak silapnya diorang LO time intake junior baru ni.

then sm cakap. "eventhough dia tu smoker, dia tu baik kan? banyak tolong kite waktu MAP haritu"

aku hanya tersengih gaya tapai basi dilenyek pesawat air asia AK5843. zapppp sentap disitu.

sm yang baru kenal waktu MAP pun actually macam lebih kenal ex roomie berbanding aku yang satu semester duduk bersama ni. D:

I think i fail to create any bond with her because...

i fail to acknowledge her. and i fail to understand her feeling. half of the "bond error" was actually my mistake. TT3TT

/sobs

i want to be a good friend like people around me. D: although i am realleh that awkward turtle. TTeTT
okbye. I will try my best! がんばれよ!

p/s: UKISS ADA KAT MALAYSIA SEKARANG D: /crying niagara falls. please somebody kidnap Soohyun oppar for me TT3TT

-_- muka dia sebijik macam Terry coursemate,

p/p/s: D: not just ukiss, but 4minute, tintap, park jung min (ajkshajhajhjafj), TOP, G-DRAGON, Seungri (askjkajkajkjdajkjajd), FT Island /cry blood tears cry

bye

2011-09-24T13:19:00.000+08:00

/o/ proud Lau follower.

Draft 1

2011-09-23T12:47:00.000+08:00

Proposal Draft 1 - status - send

Now waiting for correction phase and proceed to Draft 2 phase. D:

なんだやねん?=_____=

dear all, please value the real meaning of mind freedom before you regret D:

そんな女だった~ bye

C-C-Change!

2011-09-19T16:34:00.000+08:00

salam alaik!

I drop my German Level 1 and register myself in Nihongo Level II with afri, amirul ghazali and maybe, aten! I even ask ila to do the same but ila enroll herself in Arabic Level II (-_- ila memang ikut syariat, bagus2. semangat belajar arab orz)

I meant, beginning the registration phase, i do enroll myself in Arabic Level I. but after few consultation with some of the previous arabic no kurasu students, i decided to quit -_- then menyesal. nak daftar balik adeke dah FULL. ZOMGGGGGGGGGGGG. WHAT IS LAIF T^T

lepas balik sarawak , saya dan ila dengan tepaksa nya daftar kelas german because we haz no choice TTeTT and tbqh, kami pegi kelas pagi tadi =3= . seriously, interesting and they have different kind of pronunciation but idk TT3TT i have no interest at all. zomg WAYLT AIMI WAYLT...

masa lunch tadi afri texted me and said "aimi san kite dapat enroll nihongo leveru two~~~~ jom enrol dengan kita"

/cry happy tears.

afri and aten are two exceptional fella yang obsess dengan jpop. =_= aku rasa susah gila cari spesis kaki kaki arashi, kattun, news dalam masyarakat sebab ramai orang suka kpop D: (me too is a kpop biased too. lulz) but but. D: i love nihongo. i meant, for the sake of my future husband and children later /slap self. =_________= for the sake of me being an ultimate otaku i need to learnt nihongo YOU GOT WHAT I MEANT D: =_____= no lah no lah, for the sake of ilmu :D aceyceyh

AHHHH please call us a bunch of idiot but yeshhhh JKDSAKSHASDJKAHJAKHDAKHDA

Jaaa~ assalamualaikum huehue!

Können Sie mir helfen?

2011-09-14T18:46:00.000+08:00

Mom should be proud.

Last two semester i took mandarin and japanese.

This semester, their eldest daughter will learn how to speak Deutsch.

Lol, auf wiedersehen.

(actually at first i took arabic. lepas tu aku drop lepas tu aku nak register balik dah penuh. menyesal.)

kthanxbye

Judge me

2011-09-11T23:23:00.000+08:00

“definitely this one” Zhou Mi says, checking how he looked in the mirror with the glasses on and smiling happily that he found something to his taste.

you nodded, staring at him, you have to admit that he looked amazing with glasses, not that he didn’t look amazing in anything, he was the absolute definition of perfect, clothes, hair, skin, everything, and as far as you know his vision was 20-20, so why he was shopping for glasses was a mystery.

but you shrugged, you are merely his assistant and you know you shouldn’t concern yourself in things like this, Zhou Mi has always been kind to you enough, you need not concern yourself with his business.

you waited as Zhou Mi paid for the expensive frame, expecting him to wear them after paying, but instead, he hands them to you with a smile. ” for you”

your own glasses nearly falls down in awe, but you couldn’t “I—I can’t…I don’t” you gasp as he bent forward and takes off your glasses, being far-sighted and having to wear glasses since you were a kid,you gasped because you are practically blind without them, but Zhou Mi puts on you the new glasses he just bought and you flush at the close proximity of your face to him. he smiles at you brightly “perfect” he whispers, before walking away looking contented.

Zhou Mi has always been an enigma, but there are times he was just that much a man you cannot help but fall for.

WHY IM READING THIS FANFICT NOW FSGFDGFDFDDGHHDHDF GUISE SERIOUSLY I NEED MY LIFE BACK

/oh wait, i will get my proper life back tomorrow!

Whine up whine up whine up

2011-09-11T17:39:00.000+08:00

Lol kau tau sekarang season orang angkat beg balik univ? D: budak bermasalah macam aku memang akan tangguh2 tiket lepas tu gelabah ayam sebab tak siap kemas lagi. lagi lagi beg limit lima belas kilo je weyyyyy. apa ni. perempuan tak cukup leh 15kg tu. (profesionalism itu sangat perlu dalam mengemas beg. ikut kata hati, satu rumah tak bawak)

OMG T_T
tolong la weis. cuti dah habis ke?

beberapa hari yang lepas dalam telefon dari ila, "aimi. aimi dapat bilik triple". "hoyeah? takpa janji ada katil"

dua hari lepas dari fatin (bekas housemate, bakal arasmate) - "aimi bilik triple, sebenarnya mana ada tambah katil. ikut la macam mana, rapatkan katil, then tidur tiga orang atas tu"

tengah tengah main pesbuk, tiba tiba ada notification - dari bakal roomate. nama dia amirah
" no komen...hahahhaha....bilik air...nk tgk pun ngeri...nikan plak nk mndi...never!!!"

REACTION :-

*versi tak glemer*
JADSJADJASJKLDASJKLKLADSJDJKLASJKLSAJKLKASJJKLDSAJDASJDSJA

*versi glemer*

... ohoho.

saya malas nak complaint. saya nak datang dah lihat sahaja. batak sangat la nak complaint, tak bersyukur ke hape, ramai orang kene tendang kolej tau.

insyaAllah dikabokan ini hanya sementara. takdak kang aku tidur kat lab berak kat tandas exclusive library *naik bas semata mata kau mampu? D:* lepas tu demand wifi free dekat lobi fsts ko boleh? =_= saiko wei saiko.

p/s: tapi pokok pangkalnya kena berhenti mengeluh. TTwTT ramai tak dapat kolej lagi. ramai... alhamdulillah aimi alhamdulillah. *ulang banyak2 kali* Ya Allah permudahkan la wuwuwuwu

p/p/s: dah la tak mampu nak pk pape dah tido lagi baik. bye

because i always get angry with myself whenever i get on my nerve with somebody. im sorry. sobssss why i feel guilty now.

2011-09-09T01:02:00.001+08:00

WAYLT. WAYLT. (questioning myself) WAYLT

2011-09-08T23:08:00.003+08:00

Scar for life.

2011-09-08T23:02:00.002+08:00

Ah well. To be honest, if i was given a chance, i want to delete half of my own history.

Most of my life history made from experience that able to make me gelak sorang sorang and -_- the rest usually mengoyak nyoyakkan cell tisu hati saya. I dont get it when people said "experience will make you a better person" because seriously, whenever i look back, i believe the old version of me is... is better. i was a cheerful kid back there. papa said i was a talkative girl in kindergarten, mom said i love to wear gown and play with dolls. and why suddenly i become like this? D: can i blame puberty? or it just the rebellious gene is totally transcripted in my DNA or something -_- IDE

Today saya pegi ajar adik lelaki last saya (mind you i dont have any sister and i only ahz 3 siblings including me.) Yesh. You know, our family is basically an education oriented family. Oyaji and mama always prefer to talk about educational thingy rather than discussing who is your favourite singer pelakon etc etc siapa bakal menantu lagi lah jauh sekali. OTL ZHOUMI TAKPE ZHOUMI SAYA SAYANG AWAK AND I WILL INTRODUCE YOU PROPERLY OK BB? D:

i was like, a lil bit annoyed since my 3rd brother tak kenal huruf "h" tu apa. so saya pun ajar la dia ABC satu satu. =___________= then my mom come to defend him and said, "awak ni ajar garang sangat" bla bla bla bla. AND.. T_T for god sake, im doing this because i want my little brother to be pandai. not because of anything. YES ANAK SULUNG YOU HAVE TO HOLD THAT BULLSHIT TANGGUNGJAWAB TO EDUCATE AND EXCEL IN EVERYTHING YOU GOT ME? TTwTT

And eventually mom and dad marah saya balik sebab diorang cakap saya ni kasar sangat ajar adik -_-. omg. ;~; im sad you know im sad. ok admit la ada tinggi suara sikit but it's his fault. my 3rd brother, he is the next cho kyuhyun you got me. he is 5 years old tapi dia dah khatam game plant vs zombie, angry bird dan sekarang main farmville dekat facebook mak aku KAU MAMPU? kid nowadays. he is very good in computer and balik je sekolah terus main computer. gilaaa ;A;

ok memang ada sikit salah aku sebab aku tak check buku dia balik sekolah tadi. you know i am pressured because of my still tak habis habis proposal lagi. i was badly behind those time. im sad and emotionally volatile ok. ;_;

but is it wrong to teach your brother something? i dont care if he is sleepy ke apa. but the truth is dia penat main game ;A; BUKAN PENAT BELAJAR AJDASKJDSKAJKASJASJKS. and he cried. and lagi la double aku kena marah sobsssssssssssssssss

dear mom and dad
why.

saya masih ingat waktu keluarga kami masih susah lagi. mom used to fetch me using motor. papa kerja jauh. and we live at rumah atok. i am very close to arwah atok bah sebab atok bah will take me to warong to dine in some good food sebab dapat markah tinggi dalam exam. back there, mom and oyaji are both realleh fierce T_T saya masih ingat,

masa darjah 3 : saya belajar kuat gila sebab mom tell me "cucu atuk takde yang dapat lompat lagi, sekarang harapan penuh kat awak" yes i study hard. idk what is the real meaning of study hard masa darjah tiga OTL but yeah, i try basically. and alhamdulillah, that record is mine and still mine. mom cried during the result was announced.

masa baru baru lompat. KAU TAU MASALAH BUDAK LOMPAT? kami tak belajar darjah 4. hell no i have no basic about science, no basic about those advance math (kononnya waktu darjah 4 kan belajar yang advance sikit keke) but yeah, i am alone. =_= to be friend with somebody yang lagi tua dari kau lagi satu masalah. seriously masa 3 bulan baru masuk aku forever alone gila. dan markah aku memang jatuh golek golek la wei. sebab. sebab aku tak reti buat. saya tak reti kira perimeter, area and yes zapppp hanger sebijik. i told you during those time parent saya sangat la garang. ;A;

dan ada pernah sekali saya dapat nombor lapan. mak saya merajuk tak cakap dengan saya 3 hari tau. ;'( idk. those memories saya tak pasti orang lain dah lupa ke belum tapi saya takkan lupa ;'( ;'(

idk. banyak sebenarnya malas nak tulis. i wonder why sekarang parent saya macam longgar sikit ;A; my 2nd brother selamba je cakap pasal awek OTL . aku dulu nak mention boyfriend memang cari nahas la weyyyyy. and both of my bros rilek rilek je. dapat number berapa pun takpe /wuuuuuu. berapa A pun tak apelah, rezeki.

why.

why.

why.

-_- idk. maybe sebab saya membesar time keluarga kami susah kot? and these two brats living in airconditioned wifi environment or is it aku yang terlebih sensitive.

idk. i just feel like both of them tak merasa pressure pressure yang aku rasa dulu OTL ;A; why.
nah i dont feel like writing anymore kbye

02092011

2011-09-08T15:19:00.000+08:00

Ohai! akhirnya. akhirnya saya kembali menulis belog aceyceyh.

assalamualaikum. this is my 1st proper blog post after im officially 20 years old. DUDE IM 20 DUDE. GOOBYE NUMBER 1 ASKLJSADJKAJKASJKAS

to be honest, malam masa lepas pukul 12 tu gua nangis lu tau? D: idk. =_= tapi saya rasa macam alamak tak awesome nya ada number dua. memang tak konkrit lansung sebab menangis sebab hilang nombor satu depan umur tapi ahh kau tau aku boleh emo and nangis apa apa sebab je pon hekhekhek sebab saya kan complicated xDD

lama la jugak nangis tu, meleleh leleh air mata bhai. T^T idk, if people do notice but i do take pride about my age and being the youngest ;p ;p *gelak jahat HAAHAAAHAAAAA* kau ade xD?

ah... idk what to write anymore. =A=

Saya berazam tak nak buat kerja gila lagi memandangkan dah 20 taun dan orang semua wish 'aimi tolong jadi matang sikit" benci T_T

But but.

Yeah ohai, i am aimi. i just recently turn 20. and i am 3rd year student now. Thank You everyone for all ze warm wishes and doa. /sobs. Idk, i just bluntly reply thank you and put some silly emoji there. =///= thanks you. selamat kembali ke universiti. bawak kuih nanti kita seludup masuk lab OTL. (nama je 3rd year, tapi semua fella coursemate kelam kabut time register course? and wae, and wae, i still belum daftar pelengkap course SOBSSS - it's full) T.T

UPDATE:
ahaha. baru je tukar tiket flight 8hb jadi 12hb. SEBAB TIBA TIBA SAYA TAKNAK BALIK OTL OTLLLLL HAHAHA. papa saya ingatkan saya kena balik harini, siap leter cakap eh flight pukul berapa, kenapa tak kemas beg lagi ni xDDDDDDDDDDDDD =v= kerja gila lagi xD

=_____= proposal tak siap lagi D8 D8 D8.

I am officially 20 years old. Kekekeke. \o\ Goobye number "1" HELLO number "2" Thank You for all le wishes and dua' ;3 //SMH i should blog something but hey anime first kthansbye

2011-09-04T19:29:00.000+08:00

MY PANTS RIPPED WHILE PERFORMING

2011-09-04T19:16:00.001+08:00

THIS IS SO JDAKASDALJLDKALJDAJLKDJALDJKLADJKLAKL /ROLF HAHAHAHA

THIS BOY UP HERE . HIS NAME IS HENRY LAU

He is one of Super Junior member

and he is hilarious. enoughsaid. xDDD

何でかれがそれをしたかまだわかりません D: D: D: D: D:

2011-08-31T22:14:00.000+08:00

(p/s: saya jumpa posting ni dalam draft. ianya ditulis 2 hari lepas sebab 2 hari lepas saya bengang dan marah. OTL saya ingat saya dah post tapi rupanya internet yang siput menghalang saya mengepostnya *tapi sekarang tak marah lagi sebab raya*)

tapi saya nak post jugak sekarang =3=

lulz.kalau nihongo saya betul (sebab selama ni tak pernah betul xD) the title means

"saya masih tak paham kenapa beliau buat macam tu dekat saya".

siapa makan cili dia raya pedas >w<. kbyeee.

p/s: Btw, Al-Fatihah for Nikkichan's grandma who passed away today. May Allah bless her soul and place her among the righteous people. Amin.

Raya おめでとう !

2011-08-30T03:13:00.002+08:00

#np - f(x) ; Beautiful Goodbye . 3.01 AM
still stuck with my literature review.

Selamat hari raya! May Allah bless each everyone of you ^^ Nak minta maaf andai telah tersalah kata termengumpat terkutuk tertinggi suara, tersakitkan hati sengaja atau tak sengaja ter itu ter ini *banyak dosa OTL*, minta maaf banyak banyak ;~~~~~~~~;

Tiba tiba je saya rindu univ =_____=" haih. erm erm, to my colleagues rbiotech 09/10 , this raya is not a real raya kan kan D: D: semua bizi cari journal dan kena balik awal TT_TT we suffer a lot this year omggheeee takpe takpe what to do. tak apelah beraya dalam lab pun ok jugak tak? haha aku tak pasti boleh ke tak seludup kuih raya (takut contaminate) wuahaha tapi takpe koridor lab banyak. boleh je main pas pas popiah simpul wuahaha.

Idk but the Ramadhan feels so sekejap tahun ni, maybe sebab dapat berbuka puasa hari hari dengan parent kot wahaha. well, if i am to rate my own ramadhan, idk, TT_TT tbqh it's not perfect at all. kalau diconvertkan dalam pointer maybe aku boleh GB kot. omg asik melagha je OTL (dan akibatnye proposal tak siap siap wahahaha keji =_____=)

dah la wei. selamat hari raya. :)

dari saya dan suami. wahkahkahkah

kbai.

p/s: TAKDE KREDIT OMG D: D: BUT THANKS FOR ALL THE TEXT MESSAGE :D :D

Le dephrehhsionz

2011-08-26T14:04:00.000+08:00

academic writing is so annoying. /flips table

i need a かれし kthanksbai.

やめてよね、アイミちゃん?

2011-08-25T01:30:00.001+08:00

Oh! タイ・ワン・メイ　俺の鼓動の
Oh! Tai Wan Mei ore no kodou no
Oh! My Lady　意味は So Crazy
Oh! My Lady imi wa So Crazy
君のその瞳,　君の首筋が,　君のもう全てが…
Kimi no sono hitomi, kimi no kubisuji ga, kimi no mou subete ga
Oh! タイ・ワン・メイ
Oh! Tai Wan Mei
/cardiac arrest.
いいですよね! とても大好き! 本当に "대박"!!!!!!! ハハハー !!!

FOREVER STAN ON SJ-M

P/S: おたんじょうびおめでとうローリングール! :D
P/S: あらあら~ 疲れましたと退屈です=___= sobs sobs.

Twisted

2011-08-24T03:15:00.002+08:00

Haih. It will be a big fat liar if i say i didn't count the day. D; 9 days to go OTL

But let just put it aside, i shall whine about it, in le future.

Well, yesterday and today is a productive day for me. I'm a bit sad, yes i always sad. If i dont sad i dont ramble at my blog. Lol basically i think blog is created for a serious whiner like me to .. to actually, TELL THE WORLD THAT I HAVE PROBLEM. yes i am a serious whiner. I'm a teenager after all lol. =A=

Ok back to the story, i was a bit upset because something related to my academic /lol getting sad because of academic stuff sound so astonishing ok. before this i always get sad for some incoherent matter FML FML) and my mom was aware about my unstable emotional behavior so she dragged me to nearby supermarket. lol mom FTW. so we like spending mom-daughter kizuna (bond) moment ;- shopping for kuih raya ingredient.

FYEAH and it turn out to be the best decision ever. i love cooking and baking since my former biochemistry lecturer said experiment is like cooking. pour everything and let see the result. so if i was like, excellent in cooking baking, I'm actually a good scientist /~~(and good wife material too)~~ /incoherent hypothesis / =________=

Guess what, in two days, we managed to do biskut almond london, biskut conflake, biskut.. erm tak tau nama and few kerepek (lol johorean ish famous with their kerepek and that's why i love to merepek *pun intended orz*) *popiah goreng dah siap minggu lepas hoyeah*

HOYEAH IM SAD AND MY MOM HELP TO MANIPULATE MY SADNESS INTO PERFECT BALANGSSS OF KUIH RAYA :D :D so i no longer sad. and i'm eating my homemade kuih raya happily. ;'D YOU JELLY? 8D

Haih ok switch topic to kpop and anime =v=
I'm happy today.

Do you still remember when i blog about invincible red thread and something something about destiny? ;D basically i have theme song for that entry. AND GUESS WHAT 8D 8D 8D *happy tone is happy*

tadaaaaa

✔ Super Junior ✔ SUPER JUNIOR-M ✔ favorite track forever ✔ the best lyric ✔ IT'S IN NIHONGO OMGGG

Since it was in nihongo, i was like KYAAAA i can sing some part of the song and understand tehh meaning of those sentence lepas baru 3 kali dengar *without refering to le lyric* and the first two sentence that i managed to grasp on my 3rd time abusing youtube play button are
AI GA ARUKARA SUBETE MAKASETE YO~~~~
ITSUMO ARUKARAAAA OH DAIJOUBU SAAAAA

haih. it's too complicated to explain with word ok. I'VE PLAYED THIS SONG LIKE 30TH TIMES NOW. I LOVE THIS SONG. since it give me positive sense of security and hope (false hope? D;) because my love laifu has been pretty miserable and failure until now =________= so i need cheesy love song to enlighten my super-dark-blackout laifu pathway. ko paham tak. tak paham takpe bye.

p/s: haih sebenarnya masa mula suka SJ, first bias saya adalah kangin. lepas tu switch pergi Kibum sebab dia pendiam. then switch pergi Hankyung dan crush kejap dekat Leeteuk but basically Hankyung remain in my heart because of HANCHUL i still remember masa paah bagitau dia n intan beli tiket pergi SS2, saya bagitau paah suruh amik gambar hankyung banyak banyak. then paah reply, hankyung tak datang malaysia laa. kan dia saman company dia sendiri ;A; *fangirl sengsara* after hankyung leave i switch to Zhou Mi (i stole him from intan xD). currently i'm torn between zhou mi dan henry lau dan cho kyuhyun. tapi saya taknak buat pilihan sebab saya tamak jadi saya ambil tiga tiga sekali. sekarang saya rasa saya forever alone sebab takde sapa sekeling saya minat apa yang saya minat. like, nobody around me stan on super junior m. -_-

dan

ONEW. ONEW AYAM. ONEW TAUHU. DUBUNIM.

dan

khuntoria. haih saya takde kawan nak cakap pasal khuntoria (even kawan baik sendiri sm nadiah cakap dia benci khuntoria sejak lahir omggg ;~~~~;) haihhh dan secara instantly saya rindu dekat ila. tolong teharu sekarang. ;'D keji tak kalau saya cakap kami berdua tengok khuntoria dalam lab time practical haritu. ;'D HUEHUEHUE YOU WOULDNT BELIEVE WHAT EXACTLY HAPPEN TO US DURING OUR INTERNSHIP HARITU HAHAHA

haih takpe stan sorang sorang. tak yah rebut rebut bias :'D like example..

see this violin boy?

His name is Henry Lau and HE IS MINE.

/no argument/

okbai!

ピクチャーのコミュニケーション (pi-ku-cha no ko-myu-ni-ke-shon)

2011-08-22T02:22:00.000+08:00

Theme: Academic Counseling at Twitter.

Twitter is a good place for random thing. Random emo, trashing, fangirling and for academic purposes. ~~Good place to watch drama cerekarama too especially when you follow both of your friend and now they are couple and your timeline is full with abang sayang /eyes bleeding rainbow/~~

Theme: Lab enthusiastic.

Being a biology student will force you to enter lab like bazzilion times a week. We do suffer a lot due to endless lab report.

p/s: im sad and depress ;A;

okbai

=____=

2011-08-20T04:51:00.001+08:00

My koibito list: -

1) Kuchiki Byakuya

2) Takano Masamune

3) Hatake Kakashi

4) Sebastian Michaelis

5) Uchiha Sasuke

TTwTT bye

I dont know what happen to blogger (or my blog) lulz because saya penat penat taip dan semua tak keluar dia cuma keluar tajuk je OTL. 8D blogger is trolling me nau. Perhaps i need to quit blogging? okbai

2011-08-15T22:10:00.000+08:00

So what if i have a sister. orz

2011-08-14T17:50:00.003+08:00

Sensei FTW FTW FTW

2011-08-11T15:53:00.000+08:00

meet my sensei. aceyceyh. nah, this is Tite Kubo sensei. (the mangaka for BLEACH series. do you know Bleach? D; if you dont know then shoot yourself to death) =___=

he loves to draw. lulz. basically this image (above) ~ he draw it within 10 second /jaw drop/ (start guessing, the eyes.. looks like Ichigo ^^ but there's a possibility for Renji too keke)

after another 5 second, he already reach here. YAH IT IS SHINIGAMI DAIKO ~ Kurosaki Ichigo <3 <3

and he slowly drawing another character (not that slow. around 10 secs?) ~ Kuchiki Rukia xD /cough cough her niisama, Kuchiki Byakuya is my boyfriend ok? OTL/

lepas tu iklan...

DAN...

HOW COOL WAS THAT AJSFHASJKFHSJKFSFHDSJHFHD TOO COOL OKE. SENSEI IS AMAZING WOOT WOOT

okbai.

Zhouminism pneumothorax

2011-08-11T07:35:00.001+08:00

LOL i saw this on my facebook news feed. "japanese version cd +dvd. pre order now open ¥3,465 ~ MYR 145 (not including the delivery cost)"

SHJDHAJDHSAHSAJFHASKFHK TT_TT now i really need money. azam taknak fangirling macam dah gagal. orz

ceh saya lagi sayang sub group dari main group /fail fangirl/ -_- yes but i love KRY and SJM moar. gomen gomen.

p/s:

i have no laifu TTwTT

okbai

Alhamdulillah Alhamdulillah

2011-08-08T10:32:00.003+08:00

The faculty just call me and said "we just received your log book with evaluation form last friday."

SEPICHLESS ME JUST GO THANK YOU THANK YOU. (and i dont want to bother my brain thinking about why the borang and log book JUST ARRIVED ON FRIDAY. siapa punya salah is it? definitely not me and ila)

OK IGNORE IT BUT.

ALHAMDULILLAH. THANK YOU ALLAH ;A; THANK YOU ALLAH BECAUSE WE NOT FAILING OUR LI AND THANK YOU ALLAH FOR EVERYTHING (noodle legs /lap air mata/)

p/s: my life is full of problemoo
p/s: LIFE NEVER STOP TROLLING ME.

p/s: HE is there. TTwTT Alhamdulillah

kthanxsbai.

Tercicir dan dicicirkan berciciran /insert troll guy here/

2011-08-07T17:47:00.002+08:00

-_- (Lagu background: Arashi - to be free) *lagu tambah semangat. e_e serious tak bersemangat sekarang TwT

dalam hidup selama 19 tahun 11 bulan 5 hari ni (alhamdulillah, nak jugak kan hightlight umur ;p) saya memang selalu tertinggal TwT

minggu lepas pun dua perkara cicir tercicir dan dicicirkan berlaku TTwTT

1) tercicir nama dari senarai jaya kolej

like almuhsen said, Once upon a time in a uni, students live harmony & peacefully in residential college. Suddenly, one day, KPT decide to increase the unjuran of the new intake, all the students live in fear & feel insecure anymore..

oh yeah, that is our sad tales. TwT and my tales is a bit -____- weirder (as usual.)

nama saya dah di enlistedkan dalam 1st senarai jaya. and lepas tu tetiba one of the college staff decided to pull out another list to be published in facebook. and guess what, my name is missing from the list. ;A; ai was sepichles. TwT suddenly flash of ninja ninja memories come before my eyes. yeah, 2nd year 1st sem akan ku ingat sampai bila bila woi. that time, where my ninja ability was fully tested. honestly, i am traumatized ;A; and banyak memori trauma waktu 2nd year. patut la senior cakap sapa kawin 2nd year lepas tu tak bercerai memang rumah tangga akan kekal sampai ke tua (tapi dalam kuliah takde sape kawen lagi ;p) UPDATE: ada sorang ok bai.

=_= well. traumatized by the old incident, i created 2 backup plan, in case i am really tercicir Y_Y

1) ask somebody to double check my status at my residential college.

2) find rumah sewa.

UPDATE:

1) alhamdulillah. my friend said my name still in the list. staff tu terdelete nama aku sebab haritu dalam list keluar nama 2 kali. -_- time tu da la riak gila, nama keluar double. sekali terus kena delete padan muka. ;_; NOOOOOOO

2) i've secure the rumah sewa. perhaps i shall recommend it to my friend. [SINCE THE RUMAH SEWA fully equipped with aircond and ada PETI SEJUK 8D ]

3) backup plan. in case my kolej kediaman KEEP TROLLING ME, i probably will go for the 2nd plan. yes yes rumah sewa and ninja ninja in action ;A;

2) buku log tercicir

i received call from FRST (dari kakak comel yang uruskan li kami). dia cakap macam ni, awak dah hantar buku log?

dengan gelabahnya saya reply. dah dah. yang buku log tu fakulti tempat saya intern yang hantarkan. saya hantar report aje. sebab kononnya buku log tu private and confidental tapi sebenarnya borang penilaian tu... (taknak sambung, hanya Allah, supervisor, saya dan famila je yang tau ;p)

gelabah dengan keadaan semasa (biasa la. saya memang kuat gelabah okbai), terus telefon famila nangis nangis TTwTT

sebab mula2 akak tu cakap buku log saya je takde. buku log ila ada. D; ila n saya sama supervisor masa intern dulu, how come my log book playing ninja ninja with me D; LOG BOOK STOP TROLLING ME KAJSHDAJHDAHAJ

(lagu background betukar; Elva Hsiao - Miss Chic)

tak la kemudian, ila bgtau yang dia dah call pakcik phD n pakcik phD cakap dia dah hantar dah log book saya. siap 1 envelope lagi dengan ila punya. TTwTT how come log book saya tade. tercicir dimana mana kah? TTwTT

tak lama tu saya call balik fakulti dan kakak comel tu declare something lagi awesome "ADIK, LOG BOOK ADIK DAN ILA DUA DUA TAKDE" TTwTT

lepas tu saya call balik ila dan dua dua terus depress. terus buat posing OTL dalam bilik (takpasti samada ila buat ke tak.)

(click untuk tumbesaran in case kalau tak faham OTL tu ape xD)

SEKARANG LOG BOOK MAIN NINJA NINJA DENGAN AKU PULAK. HARITU KOLEJ SEKARANG LOG BOOK LI. KALAU ILANG LOGBOOK GAGAL LI TAU LEPAS TU TAKLEH GRAD MUDA MUDA SEBAB KENA REPEAT TTwTT *fetal position crying*

ila yang kedengaran lebih matang dan tenang cakap takpe takpe nanti ila call pakcik phD dan paksa dia carik balik buku log kita berdua. saya hanya membisu dihujung talian (ayat formal)

sekarang berdebar debar tunggu hari isnin. either orang tu dah hantar ke belom buku log kitorang or dia simpan buat perkasam kat mana mana atau memang dia dah send tapi tak sampai kat alamat sepatutnya ;_;

=A= kenapa perkara anih anih sentiasa berlaku kat saya? WAEEEE WAEEE WAEEEEE щ(ﾟДﾟщ)щ(ﾟДﾟщ)щ(ﾟДﾟщ)щ(ﾟДﾟщ)щ(ﾟДﾟщ)щ(ﾟДﾟщ)щ(ﾟДﾟщ)щ(ﾟДﾟщ)

okdah bai.

p/s: satu lagi lupa nak cerita. actually saya ter tinggal seterika kat upm trolololololo. =___=" okbai

Dont ask me to make any choice because i am srsly bad in making choice. I dont think im good in anything. okthanksbai.

2011-08-05T22:30:00.000+08:00

IM CRYING BADLY NOW

2011-08-03T02:28:00.002+08:00

niagara falls tears

Oh KRY

2011-08-03T01:49:00.000+08:00

Last Love, Last Kiss, Last Dream

너를 아는 가슴이 너만을 기억해

Goodbye My Love My Kiss

멈춰 있을 것 같아 너 없이 이대로

Last love, last kiss, last dream. My heart that knows you only remembers you.

Only remembers you.

Goodbye my love my kiss

It feels like it will have stopped. I’ll try to forget.

Like this without you. Just like this now.

homai. on replay for like. 15 times? TTwTT die la wei. Since i am hardcore SJ subgroup supporter so i ship M and KRY the most e______e i am hardcore OTL

tiba tiba teringat satu ayat dari satu cerita yang sangat epic

"There was just this hollow feeling that made him vaguely realise he'd let go of a certain thing." - Best friend, ex friend (KH x ZM , three years later)

homai. homai. suddenly flash of memories come before my eyes. TT3TT wae. i should sleep nau. please let me marry Zhoumi or Cho - EVIL - kyuhyun in my dream. okbai.

ラマダン (Ramadhan)

2011-08-01T18:13:00.002+08:00

Salam alaik minnasan. Ogenki desuka? Happi Danjiki desu (OTL fail direct translate is a major fail direct translate) *insert derp face here*

Dearest passenger, Welcome on board to this holy and bonus maximizing month. Everyone, please fasten the big stomach and nafs ~ We encourage each and everyone of you to prepare mentally & physically for puasa. :) As told by my dearest friend, fasting is not just for food starving from the early morning to maghrib, but it act more or less like cleansing act. ^o^

Kepada semua kawan kawan, saya nak minta maaf tau kalau ada tersalah silap, sebab saya seorang yang emo. maafkan saya ye. terutamanya kepada kawan yang pernah satu group dengan saya dalam lab. i em bery bery sorry. kadang kadang saya pemalas. kadang kadang saya tau borak je (sabotaj kasi contaminate sample) kadang kadang saya over rajin sampai semua saya nak sterilized. kadang kadang sebab over rajin jadi over possessive (semua menda nak buat, taknak kasik kat team member) ;_; gomenasai. Dan kepada kawan kawan lain, saya nak mintak maaf sekiranya ada terkasar bahasa, terlebih gurau.

Honto nii, i never though last year was the last time akan berpuasa dekat sarawak (sekali kena sambung master kat sarawak / sabah wakakakakakakkakaka) tapi seriously saya rindu. omggg rindu dekat sm nadiah, famila, cikot (mereka ini adalah orang yang paling banyak berjasa sebab constantly dragging me to tarawikh) - dan curik moreh xD And who can forget last ramadhan memories? :D berbuka puasa kerepek pisang dengan nadiah, sebab kelas jepun pukul 5 sampai 7 kat east campus dan kejar bas pukul 7.30pm sebab kelas mandarin 7-9 (and at the end, kami dua orang mendapat perhatian laoshi sebab selalu datang lewat. tapi laoshi sgt baik ^o^ dia memahami!). kau ade ke experience macam tu? :D truly, nadiah has been the 1st ninja member that im rooting at mars, and she's more superior than me nao. xD and that's why saya tak nak lupakan mandarin dan nihongo dan promise to myself IM GONNA MASTER THESE. these two languages memberi penyeksaan kepadaku wuwuwuwu *nada pilu

dan..

Kepada boiprend iaitu zhoumi yang berada di Wuhan China (WAHAHA OTL puasa OTL OTL), Mianhe yeobo (aceycey *slap self*), selamat berpuasa. weih engkau kat mana? ;_; kat korea ke kat china? TTwTT dah la tak hapdet Sina, lepas tu Twitter tak reti guna omai. im suffering. /slap self again, PUASA PUASA/

and to everyone, im sorry. maafkan lah saya atas segala kesalahan saya ;'( ;'(

AAAAAA *changing tone*

bulan ini saya berazam untuk

buat proposal

kesian supervisor aku menuggu. ok fain fain aku buat ;_; i hate journals homai

solat awal

;_; omg segan. but. ai olwes late ;_; ok ok i pledge to be early. insyaAllah.

bangun sahur

OTL ini satu lagi masalah. teringat masa kat KMM, siap ada announcement kat kluster B, aimi syazana, sila bangun sahur. glemer aku satu hari. ye ye. sebab kat rumah ;'D mama masak, jadi saya bangun ehehe

kurangkan fangirling

mungkin masa yang baik untuk kurangkan. TAPI ESOK LAGU SUPER JUNIOR YANG BARU KELUAR /nangis/ ok ok. kurangkan berfesbuk. twitter tak janji OTL, tumblr, tumblr bukak kejap kejap je -_- nanti hidung berdarah banyak sangat OTL. TAPI INI MUNGKIN LA. SEGALANYA MUNGKIN OTL

anime & manga... erm no comment

yaoi, ok puasa yaoi. OTP? ok kurang kan mode Qmi OTL.

selamat berpuasa kawan kawan :D dan selamat berbuka puasa!

p/s: intan dan nikki, esok ostrolia start puasa kan? :D selamat berpuasa
p/s: alhamdulillah, dapat puasa dengan family this year ^^
p/s: it's been.. a year isnt? idk. what im doing for this past 12 months. i probably been venting out my anger somewhere and keep blaming everyone. without realize, it's already a year. fufufu. and without realizing that i need to grow up :D and be a healthy young girl aceyceyh. this is my last ramadhan with number "1" at in front of my age. HOMAI I NEED TO GROW UP LER,

p.s: again. im sorry for everything guise. mohon maaf atas salah silap (apa kau pikir raya aje boleh mintak maaf?) sorry, mianhe, gomansai. sorry sorry sorry

(dance) xD

okbai.

Ashita? eh Kyou wa?

2011-07-30T00:18:00.000+08:00

T_T 30th of July, 7.30 PM (ONLY IF YOU IN JAPAN OTL). yo yo yo, so everyone has their ticket already? OH ME, SORRY SORRY AI DONT HAVE T_T

for those who not in japan and yeah perhaps another planet. lets wait for another 100000000000 leap years before this movie will be fully sub and released T_T oh pain in my heart, it's bleeding TTwTT im crying blood tears nao.

p/s: im exaggerate too much. trolololo.

just why im not in japan TTwTT why why why why why whyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyy

Bila bapak kau join tengok Naruto

2011-07-27T15:55:00.000+08:00

Salam alaik

Siapa perasan sekarang dekat cartoon network (channel 616) setiap pukul 9 malam ada naruto. naruto, belum naruto shippuden. =_= TAPI ENGLISH DUB VERSION. boooo. saya takleh terima naruto dalam bahasa lain selain the only true language of anime, JAPANESE // NIHONGO. Kalau kat tv3 ada Naruto Shippuden tapi dalam BM TTwTT lagi hancur. TAK GUNAAAA *jerit ala ala naruto dalam bahasa melayu. OTL hilang feeling...TTwTT but i still read naruto manga in translated version. oh sumimasen saya tak pro baca kanji lagi =____=

tbqh, i never shed tears while watching dubbed anime, i just lost the feeling. ah well, japanese people, you invaded half of my brain nao. TTwTT

Naa naa, adik saya selalu tengok tom and jerry (dan lepas tu Ben10) kau tau aku pun tengok Ben10 jugak, woot woot *angkat angkat kening. dan well sejak akhir akhir ni terjoin sama tengok naruto dekat CN. =_= sebab dia dub version, jadi story dia lambat sikit, baru sampai arc yang team shikamaru (ada naruto, chouji, kiba, akamaru, neji & shikamaru ^^) nak pergi rescue sasuke kekeke. ala yang dia lawan orang orang suruhan Orochimaru. ingat x time sasuke lari dari kampung dan diorang nak bawak sasuke pergi jumpa orochimaru dan time tu semua orang dalam team tu ada cursed seal mark dan lepas tu sasuke dibawa lari dalam tempayan? D8 betul ke tempayan? OTL sorry. aku tak tau nak translated okbai.

=_=" malam tadi tetiba ayah aku boleh join the club pulak tengok naruto. mama tidur awal sebab mama tak sihat. lololo. the remote tv is completely belong to meeeeeee. although i hate dubbed version, tapi sebagai peminat naruto yang jitu *aceycey* aku tengok jugak. emo gak ah dengan adik aku malam tadi. tapi beberapa minit kemudian.. *krik krik krik bunyi cengkerik*

berikut adalah sedikit sebanyak soalan bertalu talu dari papa aku -________________-

P: eh kenapa muka dia penuh tatu? tiba tiba je?

me tatu? ohh. tu nama dia Juinjutsu. ada orang jahat tu macam tanam seal. (ah what is seal in malay?) jadi nanti dia boleh control ah. sapa ada cursed seal mark ni, actually power dia double triple sebab dia pakai banyak chakra.

P: chakra tu ape?

me: =_____= ah.. power.

tiba tiba ada 1 character, aku lupa nama dia, tapi dia jerit "YOU THINK YOU CAN DEFEAT ME? THIS IS MY KEKKEI GENKAI!"

(terima kasih lebai google :D his name is Kimimaro )

secara otomatik nya bapak aku bertanya

P: Kekkei genkai tu amende? tak paham la cerita ni *nada macam nak marah* OTL

me: =_____= ahh power jugak. erm.. *terdiam menyusun ayat bagi memuaskan hati bagi orang yang 1st time tengok naruto*

P: chakra?

me: no no. ah kekkei genkai ni maksudnya lebih pada ability yang cuma ada kat setengah2 orang, ability by keturunan?. macam budak dalam tempayan tadi kan mata dia merah? tu ability by bloodline, genetic genetic haa paham x pa? /sengih macam tempoyak basi tak digest/

P: Naruto ni sebenarnya baik ke jahat? ni kenapa dia ada belang belang kat muka dia (lepas tu 3rd brother pop up with weird question kenapa dalam badan naruto ada singa?

me: TTwTT (dalam hati menangis). oh naruto baik. eh naruto kan hero, mesti dia baik. dia ada belang belang macam tu bila dia marah atau geram. dalam badan dia bukan ada singa, tapi musang laaaa =_= 9 tail fox? musang sembilan ekor? ni part 1, time dia tak berapa reti control power musang dalam badan dia tu, so kadang2 dia bertukar jadi musang. tapi masa Shippuden, dia dah reti control. tu sebab dia jadi lebih power!

P: Naruto ni orang ke musang?

me: (hujan ribut petir dalam hati TTwTT) erm orang yang ada kuasa musang? sebab bapak dia implant kyuubi dalam badan dia. dia tu vessel. (malas nak cakap jinchuuriki. T_T nanti lagi pelik pelik beliau tanya)

P: TAK PAHAM LA. NI CERITA APE NI.

me: *dalam hati* OTL =____= waee waee waeeee

okbai

p/s: naruto is one of the long run anime. dan arc dia berubah ubah. sebab tu kalau tetiba tengok tengah je mesti tak paham keke :D (dan sebab tu la saya tak tengok one piece. it's been a while saya tak baca and ai dont what to confuse myself but but hari tu saya nampak ODA SENSEI ADA LUKIS SEA GIRAFFE OTL WHAT IS ZIRAFAH LAUT? OTL nanti nanti aku pegi baca.

p/s: =_= nasib baik setakat ni takde sapa join tengok Bleach lagi. kalau tetiba ada orang join, mesti separuh gila aku nak explain, ICHIGO TU ORANG KE HANTU? =_= OTL

p/s: but i really appreciate my papa's effort, to understand at least a bit of my 3D world 8D 8D 8D

p/s: ceh ceh if i have children one day, im going to make Sunday is the anime day. lololo. habis kerja sekolah, jom tengok blasah anime sambil makan eskrim. OTL okbai.

/legitears/

2011-07-25T18:06:00.001+08:00

TTwTT i love to spam him. I love to spam @Henrylau89 with my nonsensical rambling. /epic fail/

orang yang selalu jadi mangsa spam dekat twitter, beliau hari ini sangat hemsem dan owsem. [sebab dia upload video time saya online and ai feel very hepi TTwTT it feels like our brain is interconnected kekeke]

Henry is the 1st Super Junior member to open up youtube account =w=v sasugadana! henry-san! <3

His official youtube acc : http://www.youtube.com/user/henryzzz89 (1 jam lepas dia upload video ni follower dah dekat seribu) sekarang. OTL, 3 thousand something. SMH henli <3 <3

His official twitter acc: @henrylau89

His facebook: =_____= sadly, it's for close friend and family only.

okebai hemsem. /go spam henry twitter moar/ OTL i have no no laifu. bye

(sapa suruh zhoumi takde twitter. ada iphone beli dekat US tapi takde twitter TTwTT habis menderita lara fangirls dia macam aku ni okebai)

Complexities oh YES I AM THAT COMPLEX AKJSJDJKAJJKDAJK

2011-07-23T23:57:00.002+08:00

Salam alaik
=_= saya emo sekarang. idk wae. hormone? dear future husband who still remain unknown ~~(TROLOLOLO ICANT)~~, =_= please bear with my emoness. saya tak berleter tapi saya emo sikit. saya boleh nangis dan kemudian gelak balik dan kemudian maybe the cycle repeatedly occur KJHHJDADNAJKN. i guess this is my ultimate flaws. /defeated/

(omg zhoumi ;~; i love you. your EXPRESSION IS TOTALLY THE SAME WITH MINE NAO)

sebab saya penat. sebab tu saya emo. WOMAN IS COMPLEX. or sebenarnya saya yang complex. ntah saya nak nangis sebenarnya. TTwTT *tetiba lagu sedih berkumandang dekat playlist kan. macam celaka. macam tau tau aje wuwuwu* biar saya ceritakan tragedi saya. ;~;

Tragedi kenduri di rumah nenek

Rumah nenek saya nak kenduri (omg awkward =_= aku tak panggil nenek aku nenek D8 i call he atuk mak) sebagai cucu yang =_= agak baik dan rajin (i'm the mild type like 70% tame 30% memberontak gila babas, well at least saya honest 8D) saya tolong kemas kemaskan. ye la nak kenduri, kalau fokes bab dapur je tapi living room tonggang langgang tak cool la woi. harus lah kemas. maka dengan 3 man cell formation (ala ala ninja konoha xD), saya, makcik saya dan sepupu pun membanting tulang mengemas. ;~; penat tau. lagipun orang orang tua suka barang banyak banyak dan BERAT BERAT =__= (dah rumah atok actually besar.. yes)

angkat almari, ubah kedudukan, mop lantai, susun segala gala, korek sampah sampah bawah kerusi (hidden treasure? D8 budak budak makan gula gula selit dalam kusyen? D8 D8 waeeee) saya ada masalah sikit. (ini OCD, maybe). there will be a day yang saya akan sepah kan barang macam orang gila. and there will be a day yang saya akan bersihkan semua tempat gila gila gila gila. *perangai berubah rubah macam suis, ON and OFF, saya tak tau kenapa. =_= idk, mana saya dapat gene ni saya pun tak tau. ;~; but it was officially transcripted. i cannot do anything OTL

jadi hari semalam dan hari ni mood saya ada mengemas. =_= sebab atok mak nak kenduri, maka saudara saudara jauh pun datang. (SAYA TAK KENAL KBYE) =_________= maybe sebab saya yang selalu takde kat rumah ke (bizi diperantauan kkkk xD) atau saya yang takde daya usaha nak ingat muka muka saudara or idk ;~; for the weird reason, memang ramai semalam. tak ramai la, tapi ikut average, seorang parent, ada 3 orang anak area area umur 4 5 tahun so kalau darab 4 parent, mesti la ramai. honestly saya tak berapa kenal. =_= ni anak atok ngah, atok itu atok ini, IDK IDK IDK.

=_= dan apparently budak budak tu semuanya gilaaaaa HYPER WOI ;~; saya suka budak budak. ~~(lagi lagi budak lelaki, omg aku bias)~~ and i have no problem dealing with kids (sebab saya ada 2 orang adik yang annoying dan saya terlibat aktif dalam proses tumbesaran diorang. buat susu, changing diapers, hello kalau diorang lupa jasa aku dimasa depan nanti aku tak tau la ;~;).

the only problem is bila budak budak hyperactive gila nak mati, jenis yang menyepahkan barang, tarik tarik sana, tumpahkan air, masuk bilik orang lain, pecahkan cawan kjassdja,ja,akas (DAN KENAPA PARENT DIA TAK RETI TEGUR OMG DATANG RUMAH ORANG SEPAH SEPAHKAN BARANG, MAK AKU DULU KALAU AKU PERANGAI MACAM TU, BALIK KENA SESAH DENGAN HANGER OKE?) idk, mesti mak mak korang semua train macam mak aku jugak kan. datang rumah orang duduk diam diam la. jangan usik usik. kalau usik, habis la, peha kau kena cubit takpun kau kena deathstare, dan balik tu habis la. memang tamat riwayat kau.

;~; for weird reason, saya rasa nak nangis (actually ter-mengalir air mata time dekat toilet), sebab... omg kau paham tak feeling aku? penat tau kemas ;'( DUA HARI sampai pukul 3 setengah pagi ;'(. and they totally like destroyed it TwT saya tak tau nak cakap apa kashdkajhsjkadhjkajkahfjkahkaf i cant *teary eyes.* sekarang baru aku paham kerja orang gaji tak mudah ;'( lagi lagi kalau dapat tuan rumah yang psiko orang dah kemas dia pegi terabur balik. ;'( omg seriously annoyed dan .. kemarahan kekecewaan bottle up semua. and i end up, ... idk.. saya senyap je tadi. lepas tu balik rumah. (my house kira dekat jugak ah dengan rumah atokmak) TTwTT haih kau orang paham tak feeling aku. hati ku ini remuk dan seperti belacan yang dilenyek lenyek.

Tragedi di rumah sendiri

Nampaknya bukan disitu sahaja nasib malang berpanjangan. malah berlarutan dirumah sendri omg i cant ;~: memandangkan mama bizi dekat rumah atok, jadi rumah kira macam gua yang in charge la. tapi tak payah masak, sebab bawak lauk kenduri. bila aku balik, dekat rumah ada papa, 2nd brothaa and 3rd brothaa. bertapa pilunya hati saya melihat SINKI PENUH DENGAN PINGGAN MANGKUK. /letak bunyi kaca terhempas ke batu/ i just stare stare stare stare. i am too tired to say anything so saya pun pegi basuh. lepas tu buat la apa yang patut seharusnya the SO CALLED WOMAN JOB to do. =_______=

actually our house will undergo some renovation soon, macam ada 1 bilik tu dulu store, dan mama cakap we need to transform this store into guest bedroom. senang orang datang ( hehe untuk bakal mak mertua saya dari Wunan, China lol JK JK xD *batuk* zhoumi *batuk* xD). Kalau dah namanya store, nak di tukar jadi bilik, harus lah proses pemunggahan bermula. kemas itu kemas ini. idk, im too exhausted *maybe* ye ah, dah la emo pasal tragedi kat rumah atok, sekarang kena kemas store sorang sorang (jgn tanya mana kaum lelaki masa ni. semua depan tv) ;~; ada satu masa tu papa ada tolong sikit, =_= well basically diorang ada la jengah jugak tapi lebih pada mengacau ;~;

saya start kemas dari pukul 9 pagi tadi, dan behenti kejap buka fb n twitter lepas tu sambung balik dan pukul 9 lebih (PM OK?) baru habis. since aku dalam mood mengemas, memang licin ah aku kemas. idk. wae. banyak jugak barang aku buang tadi. =__= untung jugak kemas sorang sorang, agak2 tak bekenan je buang, padan muka, sapa suruh tak tolong (TROLOLO). lagi saya, family saya memang ada favourite untuk menyimpan. entah hapa hapa, kadang kadang pelik, KOTAK RADIO JENAMA PANASONIC dengan polisterin dia pun nak simpan. aigoo. memang aku buang ah. omg emo + weird hormone turn on = perfection. lepas ni jangan tanya mana itu mana ini, kuasa di tangan saya. saya buang. (HAHAHA xD)

lepas kemas store (perfect clean okey?) /bangga/ i was soo like not in the mood of eating or whatsoever. memandangkan adik 2nd saya balik, dan bilik dia pun nak renovate jugak, jadi dia tumpang bilik saya. omg lelaki, kenapa suka buat sepah TTwTT. simply to put, lepas seharian saya kemas store, saya penat, saya nak baring. i want my bed badly. dan masuk bilik dan tengok komik kesayangan bersepah sepah memang bukan scenery yang aku minta pada saat saat ini.

NAK BACA BOLEH TAPI KEMAS LA BALIK ;~:

again. saya malas nak cakap banyak so saya kena susun balik (=____= susun ikut volume. mana boleh susun random random boooooo).

omg seriously aku tak paham sekarang tapi aku memang seriyesly nak nangis /peluk bantal/

TTwTT

seriously TTwTT macam takde orang appreciate je kerja gua. TTwTT ingat senang ke nak mengemas. saya pun sebenarnya type penyepah jugak. as i said earlier, memang saya suka sepahkan barang, but on the brighter side, saya akan kemas balik TTwTT omg kenapa orang suka sepahkan barang kemudian tak reti kemas balik. TTwTT *teary eyes* *takungan airmata mengelabukan tahap penglihatan* perhaps saya exhausted sebab tu saya emo macam ni dan esok esok lusa mesti aku menyesal tulis entry ni but for time being, saya nak tulis jugak TTwTT i feel my anger, disappointment , tiredness all bottle up inside my head and i dont know where to lepas kan TTwTT idk. this is sick.

perkara paling takbest adalah bila kau seorang perempuan dan kau anak sulung idk waeee waeee semua kerja jatuh pada kau. mesti ada orang cakap aku ni kaki mengeluh pengorbanan aksjhfajkfhjkafnajs,najnsm TTwTT ah biar lah saya tak kisah, saya tak tau nak lepas kat mana lagi, TTwTT only this bloggg omggg im totally frustrated with everything /guling guling/

i probably suffer from kitchen complex. no no. not just kitchen, living room, bedroom, store room?, basically TTwTT i can't tolerate dengan orang yang sepahkan barang yang saya dah kemas TTwTT kecewa tau. wuwuwuwu.

i feel like crying. kthanksbai.

p/s tak jadi nangis. TAK COOL. kekeke. saya nak pegi ikut nasihat intan jap. *asah garfu*

p/s: i have pepsi. you jelly?

TTwTT

okeybai.

stare stare stare (笑)

2011-07-22T10:22:00.000+08:00

hello,,how is everyone?

1)cuti semester selalu membuatkan skill stalker dan spammer saya bertambah baik. plus paah ajar saya cara cara nak menggunakan megaupload dengan mengubah ip address and the details goes in very very details *cehceh*. so another devilish skills gain :D *proud proud*

2) plus semalam saya main game sampai tangan kanan saya.. kebas. =_=" idk, sampai hari ni pun dia still kebas lagi (tapi boleh gerak ah.) idk. semalam sampai menggigil takut =_= ye ah penah baca tak artikel kat sokabar yang dia cakap ada budak kena undergo pembedahan sebab main sms lama sangat (idk carpal tuner syndrom?). ;~; homai. (tapi hari ni main lagi xD)

3) oh yeah? kenapa sejak akhir akhir ini blog update dari kawan kawan semua bertemakan jiwang jiwang? (笑) kekeke

What was life before the invention of internet and play station?

*laugh*

(p/s currently playing Naruto the ultimate ninja 5 ^o^) it takes sweat, blood and tears to win in each stages yo!)

babai.

SAYA TUNGGU SAYA TUNGGU. TTwTT Cepat la sampai.

2011-07-19T15:08:00.000+08:00

Serius, poket tebakar. bye

The nodules

2011-07-18T15:33:00.001+08:00

Saya tetiba baru perasan pagi ni, bila bangun tidur, rasa macam thyroid nodules yang dekat leher tu dah macam mengecil.

(sebalik nya aku terasa gemok sebab malam tadi sebelum tidur aku makan temaki sushi OTL and and lepas tu pagi tadi pun sarapan temaki sushi sekali lagi kemudian tengahari tadi makan tengahari pun makan ebi & tamago sushi *maksud dia lepas ni aku kena nyanyi lagu sambil mengadap matahari terbit* =____=*

Apa pun, alhamdulillah :)

p/s: still on medication, if you ask.

p/s: sushi beli borong dekat tesco. lepas tu sumbat dalam peti sejuk banyak banyak. xD

bye

Teringat tragedi lama lama

2011-07-18T03:14:00.002+08:00

Salam alaik

Hari tu aku bizi berborak dengan rakan rakan pasal lesen kereta. Alhamdulillah, aku dah ada lesen kereta, setakat kucing tu dah master dah *padahal berapa kali sesat =_______= jalan pergi epot je woi aku master. tu je jalan yang AKU PASTI memang menuju ke arah kebenaran*

motor aku tak ambil sebab aku prefer jadi rempit okbai.

Last last ada sorang aku cakap yang dia test pagi tu dan dia fail bab jalan raya. serta merta seperti direnjat elektrik aku terasa dejavu. ;~: dulu aku pernah gagal test jpj part jalan raya. celaka betul. malu aku terhadap tomahan masyarakat woi.

Macam ni, waktu awal awal training, yang uncle ajar tu selalu tulis giliran aku belah petang. belah petang aku tak pasti kenapa tapi uncle ni selalu je bantai tidur time aku bawak kereta. DIA BAJET DIA NAK MATI SYAHID KE HAPE? D8 tapi selalu dia tidur, lagi lagi kalau aku on test jalan raya. maybe dia tidur tidur ayam kot nak uji kecekalan aku memandu. begitu la, mungkin OTL

tapi pakcik ni emo siot. time ajar aku bab bukit, peh dah ah aku baru belajar pegang steering, dia nak suruh buat action ala ala istana takeshi (=_= ala yang tekan minyak macam nak terbang kan kereta tu? you get me?). well let said dia patut bersyukur aku antara the brightest student sebab aku dengar cakap wakakaka.

Time test JPJ, malam tu lewa lagha. kengkonon bajet hotsetap boleh lulus dengan cyberjayanya. esok tu pagi pagi test bukit, parking dan three turn. tu okey la, cemerlang. (perasan xD)

time datang part jalan raya tu, aku dah gelabah da weis. tengok jpj duduk sebelah wuwuwu. tapi time tu kena macam pagi, tapi tak la pagi pagi. macam pukul 10 lebey macam tu. jalan kosong weis :D *lega. time cross jalan then masuk gear semua lancar.

TAPI JALAN CLEAR SEBENARNYA LAGI MEMBINASAKAN WOI T_T

saya terlalu nervous sebab brader jpj tu duduk sebelah dan nada garang dia buat gua lagi nervous 30 megawatt OTL. dah jalan clear, mesti la tekan je minyak kan? aku lupa ada kawan pesan cakap jangan bawak lebih 80. sebab kadang kadang diorang akan fail kan korang atas sebab ni je (tapi banyak aku dengar cerita jpj lagi suruh laju ada ar untung ah weis! xD)

tetiba aku dengar perkataan yang paling aku tak nak dengar dalam dunia.

"DIK BERHENTI TEPI DIK"

oh dem =_____________=

dia kata aku bawak lebih 80. celaka wei memang celaka. balik tu nangis kot, terus isytihar tempoh berkurung dalam bilik sebab malu kepada tomahan masyarakat xD

alhamdulillah bila aku retest balik dan

LULUS ^^

hihi. korang pernah fail jpj tak OTL *soalan jenis apa ni.

dah la bye

p/s: satu lagi sebab aku tulis menda ni, sebab aku kena gelak dengan parent aku dari semalam. sebab aku bagitau diorang kereta idaman aku bila da besar nanti myvi jek T_T ~ wuwuwu

f(x)&shinee - Lolipop. addicted OTL

红线 - (i think it's pronounce as Hong Xian) OTL I forget ler. OTL

2011-07-15T00:13:00.001+08:00

“An invisible red thread connects those who are destined to meet, regardless of time, place, or circumstance. The thread may stretch or tangle, but it will never break.”

—An ancient Chinese belief

OMG i know, this is cute isnt it? :D This is my first time hearing a chinese folklore about Hong xian from a singaporean friend at twitter ^^, (i think .. saya rasa la, the way to pronounce it is. hOng (huruf O tu bacaan kedua), then xian (huruf A tu bacaan keempat) OTL go learn the 4 tones of mandarin, up to now, i still fail to masterized it -_- takyah gelak ah kthanksbai

But anyway, as we talk rather informally at twitter, i find that it's useful if i try to find the nearest original version. Well idk if it's original or not but jyeah, wiki is always there huehue.

The folklore for Hong Xian :D

One story featuring the red string of fate involves a young boy. Walking home one night, a young boy sees an old man standing beneath the moonlight (Yue Xia Lao). The man explains to the boy that he is attached to his destined wife by a red thread. Yue Xia Lao shows the boy the young girl who is destined to be his wife.

Being young and having no interest in having a wife, the young boy picks up a rock and throws it at the girl, running away. Many years later, when the boy has grown into a young man, his parents arrange a wedding for him. On the night of his wedding, his wife waits for him in their bedroom, with the traditional veil covering her face. Raising it, the man is delighted to find that his wife is one of the great beauties of his village.

However, she wears an adornment on her eyebrow. He asks her why she wears it and she responds that when she was a young girl, a boy threw a rock at her that struck her, leaving a scar on her eyebrow. She self-consciously wears the adornment to cover it up. The woman is, in fact, the same young girl connected to the man by the red thread shown to him by Yue Xia Lao back in his childhood, showing that they were connected by the red string of fate!

OMGGGGGGG WHY THIS STORY IS SO CUTE >3<

=//= *red face* *face palm* *rolling on the bed*

p/s: deep apologize for my lame mandarin. -___- *derp face everywhere*

p/s: HEY HEY HEY it's 12.05 AM already , and it is officially 15th of JULY :D .

Today is my mama's birthday! Happy birthday mama!

Hari ini hari ulang tahun kelahiran mama saya! Selamat hari lahir mama!

Kyo wa watashi no haha no tanjoubi desu! Tanjoubi omedetou!^^

Jintian shi wo mama de shengri! Shenri kuaile mama ^^ Wo juede hen gaoxing! Xie xie mama! Wo ai ni! OTL OTL fail mandarin is forever fail.

p/s =_= ~~why suddenly i want to marry a chinese man?~~ OTL just kidding

OTL ~~BUT ZHOUMI AGREE~~ OTL OTL OTL I CANT EVEN.

p/s: ah saya masih dalam proses buat kad untuk mama saya :D

babai.

SAYA TAK START MENULIS REPORT LAGI OMG 10 PAGES OMG OMG

2011-07-10T14:31:00.002+08:00

is it really 10 pages? щ(ﾟДﾟщ) takkan *sedapkan hati*

brb im drying. ZHOUMI ZHOUMI ZHOUMI TOLONG SAYA TAIP REPORT WUWUWUWUWU

bye

Owari Yokereba Subete Yoshii

2011-07-10T02:00:00.000+08:00

Salam alaik.

Semalam hari last saya bekerja. eh tipu, last day of my internship fufu . Let me list down what i did yesterday and the other yesterday (aku tak tau term dia sori orang kampung, english fail xD).

// bangun pagi
// lari kejar bas (oh kami awal sikit hari ni. dapat bas 9.30 *so secara otomatiknye jangan tanya pukul brape aku masuk kerja. waktu orang orang masuk kerja adalah subjektip HAHAHAHA
// arrive at faculty
//assist some of graduate students doing their analysis. ~ tolong buat 0.01M acid tu, 0.1M alkali ni =_= ahh typical work for lab geek.
//tunggu dan menunggu sample
// sambil menunggu spam twitter
// spam tumblr
//spam twitter lagi lagi lagi. orz =_= gomen. it's an addiction now. D8
// buka facebook. baca status kakak master. diorang nak belanja makan YAY!

// lunch time xD
// lapar. =______=
// waiting for akak akak master
// diorang datang dan cakap jom jom~
// diorang bawak pergi 1 restaurant Nasi Ayam Penyet kat cyberjaya. i dont remember the name but but honto niii!!! best!!! totally authentic indonesian food. pedas gila sambal dia. BUT WE CANT STOP. aaaa\
// balik terus direct pergi .. pejabat LHDN somewhere dekat bangi. ah time tu first time saya lalu depan UKM. OH JAKUNNYA GOMENASAI. TwT
// tidur dalam kereta.
// famila kejutkan sebab tak pakai seat belt. =_______= depan mata ada polis. orz
// solat zohor kat petronas.
// beli 16 bar coklat cadbury :D untuk ahli ahli soil lab tersayang! hikhik. tanda kenang kenangan. jangan rindu kami fufufufufu
//singgah Institute Biosains
//balik lab

// farewell party - goreng pisang, milo ais, teh o ais, sesi bergambar, sesi #Bersih kan lab xD, sesi bermaaf maafan.

// LI habis. babai Soil Lab!

// balik ambil bas depan fakulti terussss pergi The Mines. HAHAH we need to celebrate and splurge our money la of course!
// eat too much cheese =_= xD pizzahat!
// feels fat. jalan kaki dan tunggu bas.
// abang bas lambat, tumpang parent famila balik kolej haha.
// pintu shortcut dia kunci =________= MANGGA BESAR!
// well, saya kan ninja. PANJAT PINTU PAGAR TU xD
// famila and her mom did it too. omgggg idealisma ninja telah berkembang dengan baiknya! yo yo!
// famila kemas barang dan balik
// saya duduk sorang sorang

bermulalah kehidupan bujang yang sangat menghiburkan

// anime anime anime
// facebooking
//spamming on twitter
// tumblr
// stalking =___=" zhoumi zhoumi zhoumi
// twitter again
// tumblr again
//tak ingat bila tertidur

BYE!

p/s: malam tadi mimpi best!
p/s: Owari Yokereba subete yoshii maksudnya semua yang baik berakhir dengan baik :) fufu

p/s; tak mampu buat entri sedey sedey bagai macam orang lain kat blog pasal Li diorang hahaha
p/s: saya takde kamera so. =_= takde gambar. gomen. miskin.

Darwin

2011-07-08T12:24:00.001+08:00

Ustaz saya pernah kata, walaupun harun yahya banyak membongkar kecelaruan2 dalam ideologi2 barat, tak semestinya beliau 100% betul. bila berkata tentang evolusi, semua nak rujuk harun yahya. harun yahya kata tu, harun yahya kata ni. berlaku ketidakadilan dalam pengambilan sumber ilmu.

kita tak pernah tau pun apa itu teori Darwinism, apatah lagi membaca habis dan faham bukunya ‘The Origin of Species’, terus je baca atau menonton dokumentari harun yahya ttg evolusi. lepas tu terus je buat konklusi yang teori evolusi itu bertentangan dgn Islam tanpa membuat perbandingan yg lebih jauh. evolusi seolah2 dah jadi satu allergik kepada umat islam.

kalau membicarakan evolusi manusia kepada beruk, sudah tentu saya sendiri menolak. akan tetapi evolusi bukan hanya bicara pasal beruk jadi manusia. banyak lagi aspek lain. siapa2 yg pernah belajar genetic atau microb tentu tahu yg evolusi ni banyak berlaku pada tahap cell. itu evolusi yg kita tak boleh nafikan kerana ada kajian saintifik yang terperinci tentangnya; bukan sekadar ‘teori’. harap maklum. - komen dari blog Saifulislam

1) Kenapa kita umat islam terlalu allergic dengan perkataan evolusi? evolusi je teruk keluar beruk? evolusi je terus harom! evolusi je terus kapir!

2) Saya tidak pro-darwin tapi saya lemas dengan keadaan masyarakat yang suka pukul rata perkataan darwin dan evolution

3) Saya menulis entry ini sebab saya tiba tiba di tanya begini dekat facebook "eh kau pro - Darwin ke? lol")

4) Jawapannya tidak. saya tidak pro darwin.

5) Saya masih ingat lagi seorang professor yang mengajar saya subjek biodiversity. Dia cakap macam ni, yes Natural Selection sometime reliable too. Mungkin teori penciptaan alam secara semulajadi memang harus lah ditolak tapi dalam theory tu, dia ada bahaskan, the fittest will survive.

Kalau tok nenek kita tak survive zaman jepun dulu, ada ke kita? Ada awak duduk depan saya ni dalam nikmat belajar begini?

Saya terkedu. betul. for the first time, i kinda understand something yang dia nak deliver. heh *feel like a boss xD*

Wallahualam. Saya masih cetek lagi ilmu.

p/s: saya rasa orang kita kena rajin rajin membaca.
p/s: cuba baca sini http://saifulislam.com/?p=776

I forget my own brother's birthday

2011-07-06T12:33:00.001+08:00

Well yah. THE TITLE kinda off describing the whole situation *evil smirk* (￣ー￣)

I even forget his phone number orz orz

Unnn, ano~~~ =_____________= gomenasai. i have no money to buy present. Basically all my living expenses are from pa&ma (yah pitipitipu tak masuk lagi, even my internship allowance pun takde lagi what even a day ;~;) jadi saya bangkrup. =______________________=

Well let see. Dia tak tau saya ada blog maybe so i can quickly slash his throat here xD. My relationship with him is kinda on/off relationship. We dont talk much between each other but we do understand each other better with those quiet moment =_=, i meant masa kecik kecik dulu memang ah mesra bagai, =_= then when puberty hit you, and everything change.

I guess that's how brotherhood relationship should me. Annoying la kau kalau jadi kakak yang nak menyebok setiap masa hal adik adik eww. (yes. i really hate the type who classify kak long need to stick nose in every brother/sister punya hal. mind you i have my own problem. =_= kadang kadang boleh lah. selalu sangat macam sangat ewwwww )

Well.. Happy Birthday big brother AFDanial! May Allah bless you always :) Have a blast and stop messing around with my room! Hahahahah!

And i guess saya takde idea nak tulis apa lagi. Lemme just hightlight our brotherhood similarities and differences, hmm *professor mode ON*

Similarites

1) =_= kami berkongsi DNA dari mama dan papa *yes obviously kan adik beradik*
2) We love keroro gunso
3) We love Japan
4) We love Anime
5) We love weird songs.
6) We love to abuse laptop. -_-
7) We practically love to spend our whole life in front of laptop rather than socializing
8) We love to eat
9) We love Sushi *but mom hates it. =_= tau tak kat rumah saya ada peraturan, jangan makan sushi depan mama, nanti mama marah =________________= how i'm suppose to marry a JAPANESE like this? D8
10) We both can cook well *bahaha self compliment!*. (and destroy our mom kitchen too *cough cough)
11) HE IS HANDSOME LIKE ME. 8D

Differences
1) He is 17+ CM and i am 16+ CM . I am short. And in 10 years time, i shall become the shortest =_=" Danish will hit puberty too during that time and yes yes, saya akan jadi terpendek *air mata berlinangan*
2) He has long legs while i... *sambung sendiri
3) =_= Dia ramai girlfriend.. dan.. saya *sambung sendiri*
4) He has 3 name AFD, even Danish too ADF =_= while i have only two ._. AS
5) He is really good in sport while i am.. ._. *sambung sendiri

......

6) He love me but i just really really really hate him *kidding*. * BHAHAHAAHHAHA*

Well anyway, Happy 16th birthday brother! xD

p/s: in case you discover this blog in the future, don't kill me. -_- i'm still 19th years old while i'm writing this *alasan* xD

bye!

Tinggal Seminggu

2011-07-04T02:15:00.002+08:00

Tinggal seminggu lagi sebelum tamatlah krisis emosi dalaman aku sebagai saintist paling emo dalam lab tanah. kemudian i am a free man bebeh. JYEAHHHH!

HAHAHAHAHA. 1 WEEK LEFT. WOOT WOOT GANBAREMASSHOU!

p/s: -_- tapi log book dan report tak buat lagi.

p/s: duit gaji bila nak masuk? D; D;

okebai!

Kau pernah terfikir macam ni tak doh?

2011-07-03T04:35:00.000+08:00

Aku tak boleh tidur -_-

i meant, yes. kalau saya tidur lepas tu ada orang terperanjatkan saya memang lepas tu no way aku nak tidur balik. ;~;

dan kemudian mula lah terfikir benda pelik pelik ..

pernah tak korang terfikir, kalau...

kalau ALIEN datang ke bumi ? i meant, -_- saya nak mengantuk dan saya pasang ah tivi cerita national geographic, tajuk dia pasal possibilities untuk kewujudan extraterrestrial organism. well. -_- tapi saya mengantuk. cerita tu stimulate otak aku kerja pulak demm

okey sambung..

hm -_-

kalau alien datang ke bumi, diorang buat ape eh?

a) adakah dia akan serang bumi dan musnah kan bumi?

b) dia hipnosis manusia suruh ikut cakap dia? *pengaruh Uchiha Madara yang tinggi, yes yes theory of the red moon "Akatsuki" OTL OTL*

c) or dia menyamar or carmouflage jadi manusia (kat alien boleh tukar tukar kan?). lepas ni alien boleh ada facebook OTL OTL

d) or dia boring -_- dan fly balik planet dia.

ce pikir sikit. D; selalu cakap nanti alien datang tapi ce pikir ektibiti alien once dia sampai bumi? OTL OTL WAE IM THINKING LIKE THIS? *tengok jam..* pukul 4.46 pagi.

PUKUL BERAPA AKU NAK TIDUR NI WEIS

-_- bye

유키스 - 내게 아픈 말은...

2011-07-02T02:56:00.001+08:00

오 그대 가슴 아픈 말은 제발 하지 말아요

나만 사랑한다 말했잖아요

제발 이렇게 나 떠나지 마요

오 그대 가슴 아픈 말은 제발 하지 말아요

그댈 바라볼 용기가 안나요

제발 이렇게 날 떠나지 마요

Terasa seperti...

2011-07-01T00:10:00.000+08:00

-_- sebenarnya saya jeles gaban melihat rakan rakan pergi kejar Beast kat LCCT esok. oh ye ieyra in case you read, tolong curik junhyung ><

Saya rasa sudah tiba masanya untuk membazir sedikit duit untuk kpop mebi?...

kalau nak pergi concert memang gerenti putus darah dengan bapak sendiri (sebab dia tak bagi. =_= beliau cakap ramai orang nanti either saya kena culik. atau saya kena pijak TTwTT adekeee adekeee)

saya harus membeli sesuatu..

HEH HEH. STOP KILLING ME WITH THAT SMILE HEWHEWHEW

maka saya decide nak beli album SJ-M dan berdoa dapat poster abang MiMi besar besar. aci tak? :D

p/s: sebab selama ni asik beli pasal anime je -_-

p/s: duit mana duit?

Persengketaan muda dan tua

2011-06-30T14:27:00.000+08:00

Lecturer saya pernah cakap. Masalah dunia sains sekarang, saintist tua taknak dengar cakap saintist muda. Saintist muda yang memang berdarah muda lagi lah tak hingin dengar cakap saintist tua.

Memang la. Saya sendiri sebagai generasi muda masa kini (muda la kan? :D baru 19 tahun ehehe) memang jarang nak dengar cakap orang tua tua. Rebellious kot? D;

Tapi lepas tu lecturer saya cakap takpe ini kejadian yang menyihatkan. Kita ikut cakap saintist yang lebih berpengalaman tapi pada masa yang sama kita try explore cara / method atau discover benda benda baru. It's all related so jangan risau dah dia kata menyihatkan takpe la kalau kau sonsangkan test tube walaupun dalam manual suruh letak 90 darjah. wakakaka.

mungkin. mungkin sebab zaman kita berbeza barangkali?

sebab tu gaya pemikiran lain?

idk.

Situasi 1

Hari tu kami ada buat beberapa soil analysis dengan abang master dan pakcik phD. lepas tu pakcik phD cakap, okey lepas 2 jam kita letak ni 10 ml.

lepas 2 jam, kami pun prepare ah nak tuang 10 ml. jam di dinding telah menunjukkan pukul 4.30. tak lama kemudian azan asar pun berkumandang (kenapa titibe mode kecerpenan ni?) ikut theory orang muda muda macam kami, termasuk lah brader brader GS, dia cakap, ala senang, ambil 1 test tube tuang 10 ml. lepas tu hang letak sebelah test tube tu dan compare. tambah ikut height dia je. maybe sound not accurate tapi menda ni kita nak at the end dia jadi 1ml jugak. so no worries ah.

tetiba pakcik phD sergah dari belakang dan start buat tone annoying.

"mana boleh tuang macam tu je. tak accurate. bla bla bla bla. ketebalan test tube. bla bla. bergantung pada company. bla bla. this is made in Japan dan this is made is Germany bla bla. kualiti kaca berbeza beza bla bla.'

berdesing telinga masing masing.

alih alih abang abang GS pun balik dan kami berdua terduduk lesu sampai pukul 9 malam kat lab semata mata nak tuang mende alah 10 ml tu dalam 40 bijik test tube. -_- mendokusei nee.

besok pagi tetap nak suruh cecair tu jadi 1ml jugak. leceh. =_=" (dan bengang sebab penat.)

Situasi 2

Tengah tengok anime gelak gelak dalam lab (masa ni tunggu incubation period) - masa ni semua orang relax relax dan borak borak.

biasalah, orang muda muda memang kaki buang masa kekeke. laptop memang penuh dengan anime dan drama korea / jepun kan? 8D HAHAHA. hilang keremajaan kau bila takda benda benda ni *kidding*

tetiba ahli ahli pakcik pakcik phD start open table pasal politic.

"haa kerajaan kita ni pong pang pong pang pong pang"

"saya tak setuju bla bla bla"

"saya rasa dia ni tak patut naik"

tiba tiba aku speechless tak tau nak balas apa. hahahaha. xD

-_- maaflah. tapi kena terima, era tumbesaran pakcik dengan era tumbesaran kami lain kot D8

Situasi 3

aku ada kawan yang obsess dengan politik dan hal kenegaraan dan suka menyembang pasal hal serious. setakat Ao No Exorcist ke, JunHyung dengan Hara couple ke, Naruto dengan Sasuke ke memang duniawi habis. no no no.

=_= bila diorang start ajak borak je. aku paling loser dan paling tak tau apa apa.

tapi ni kes rakan sebaya jadi tak boleh claim era tumbesaran berbeza. perhaps tumbesaran minda diorang rapidly advance kot? maybe diorang minum anmum gold ? D8

Situasi 4

Banyak benda saya tak share dengan parent saya..

Sebab kalau saya share nanti parent saya freak out. 8D .

eheh? memang zaman kita berbeza kot? ke planet kita berbeza? kbye.

p/s: entri ini tidak menyindir mana mana pihak. tapi yang kejadian kat lab tu memang berlaku. HAHA

__

Irrelevant Part II

Batang pancing.

Irrelevant

Genetically modified half nippon babies D: ?

ただいま!

kehilangan cinta duda sengsara

Photokepshen

bitter reality

tsuyoku....nai

enzymology

Blackout

aku dah abes exam

emo management

ふくざつ

tak best

Gerhana mata hitam ku

ALL IS WELL. /LIESSSSS

Berjakun jakun wishlist

Macam mana la saya tak sayang

Post Apocalypse

Wishes

Hidup bermasyarakat

laptop buat perangai (kot?)

Well...

=_=

le kpop invasion

raye wei raye

Selamat hari raya aidil adha

Study + dying = Studying

IT HAS BEEN SO GOOOD

If your friend still befriended with you, even after the worst karaoke session. Then trust me, he or she is your true friend.

Kerlasss kau jah!

-_- lapar la pulak taip taip proposal ni

Meow.

Osashiburi desu yo~. Before that, it's been a month i didnt watch Naruto Shippuden. This is sick. Let's ignore the fact that i am procrastinating for today. Im going to watch Naruto like boss right now ToT /ignore the proposal and assignments. Im doing it. BYE

Danger

Neko

Perut didahulukan, proposal dan nota kuliah dikemudian kan

Semalam hari yang tak berapa bagus

Oyaji no danna!

Pergi

絆 (Kizuna)

Draft 1

C-C-Change!

Können Sie mir helfen?

Judge me

Whine up whine up whine up

because i always get angry with myself whenever i get on my nerve with somebody. im sorry. sobssss why i feel guilty now.

WAYLT. WAYLT. (questioning myself) WAYLT

Scar for life.

02092011

I am officially 20 years old. Kekekeke. \o\ Goobye number "1" HELLO number "2" Thank You for all le wishes and dua' ;3 //SMH i should blog something but hey anime first kthansbye

MY PANTS RIPPED WHILE PERFORMING

何でかれがそれをしたかまだわかりません D: D: D: D: D:

Raya おめでとう !

Le dephrehhsionz

やめてよね、アイミちゃん?

Twisted

ピクチャーのコミュニケーション (pi-ku-cha no ko-myu-ni-ke-shon)

=____=

I dont know what happen to blogger (or my blog) lulz because saya penat penat taip dan semua tak keluar *dia cuma keluar tajuk je OTL*. 8D blogger is trolling me nau. Perhaps i need to quit blogging? okbai

So what if i have a sister. orz

Sensei FTW FTW FTW

Zhouminism pneumothorax

Alhamdulillah Alhamdulillah

Tercicir dan dicicirkan berciciran /insert troll guy here/

Dont ask me to make any choice because i am srsly bad in making choice. I dont think im good in anything. okthanksbai.

IM CRYING BADLY NOW

Oh KRY

ラマダン (Ramadhan)

Ashita? eh Kyou wa?

Bila bapak kau join tengok Naruto

/legitears/

Complexities oh YES I AM THAT COMPLEX AKJSJDJKAJJKDAJK

*stare stare stare* (笑)

SAYA TUNGGU SAYA TUNGGU. TTwTT Cepat la sampai.

The nodules

Teringat tragedi lama lama

红线 - (i think it's pronounce as Hong Xian) OTL I forget ler. OTL

I dont know what happen to blogger (or my blog) lulz because saya penat penat taip dan semua tak keluar dia cuma keluar tajuk je OTL. 8D blogger is trolling me nau. Perhaps i need to quit blogging? okbai

stare stare stare (笑)